Ecology

1.Garcia, J. R. & Gerardo, N. M. The symbiont side of symbiosis: do microbes really benefit? Front. Microbiol. 5, 510 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
2.Law, R. & Dieckmann, U. Symbiosis through exploitation and the merger of lineages in evolution. Proc. Biol. Sci. 265, 1245–1253 (1998).PubMed Central 
Article 
PubMed 

Google Scholar 
3.Keeling, P. J. & McCutcheon, J. P. Endosymbiosis: the feeling is not mutual. J. Theor. Biol. 434, 75–79 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
4.Wooldridge, S. A. Is the coral-algae symbiosis really ‘mutually beneficial’ for the partners? BioEssays 32, 615–625 (2010).CAS 
PubMed 
Article 

Google Scholar 
5.Mushegian, A. A. & Ebert, D. Rethinking ‘mutualism’ in diverse host-symbiont communities. BioEssays 38, 100–108 (2016).PubMed 
Article 

Google Scholar 
6.Mathis, K. A. & Bronstein, J. L. Our current understanding of commensalism. Ann. Rev. Ecol. Evol. Syst. 51, 167–189 (2020).Article 

Google Scholar 
7.Ewald, P. W. Transmission modes and evolution of the parasitism-mutualism continuum. Ann. N. Y. Acad. Sci. 503, 295–306 (1987).CAS 
PubMed 
Article 

Google Scholar 
8.Bronstein, J. L. Conditional outcomes in mutualistic interactions. Trends Ecol. Evol. 9, 214–217 (1994).CAS 
PubMed 
Article 

Google Scholar 
9.Schu, M. G. & Schrallhammer, M. Cultivation conditions can cause a shift from mutualistic to parasitic behavior in the symbiosis between Paramecium and its bacterial symbiont Caedibacter taeniospiralis. Curr. Microbiol. 75, 1099–1102 (2018).CAS 
PubMed 
Article 

Google Scholar 
10.Osman, E. O. et al. Coral microbiome composition along the northern Red Sea suggests high plasticity of bacterial and specificity of endosymbiotic dinoflagellate communities. Microbiome 8, 8 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
11.Kümmerli, R., Jiricny, N., Clarke, L. S., West, S. A. & Griffin, A. S. Phenotypic plasticity of a cooperative behaviour in bacteria. J. Evol. Biol. 22, 589–598 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
12.Kumamoto, C. A. Niche-specific gene expression during C. albicans infection. Curr. Opin. Microbiol. 11, 325–330 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
13.Thrall, P. H., Hochberg, M. E., Burdon, J. J. & Bever, J. D. Coevolution of symbiotic mutualists and parasites in a community context. Trends Ecol. Evol. 22, 120–126 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
14.Chamberlain, S. A., Bronstein, J. L. & Rudgers, J. A. How context dependent are species interactions? Ecol. Lett. 17, 881–890 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
15.Sachs, J. L., Skophammer, R. G. & Regus, J. U. Evolutionary transitions in bacterial symbiosis. Proc. Natl Acad. Sci. USA 108 (Suppl. 2), 10800–10807 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
16.Hosokawa, T. et al. Obligate bacterial mutualists evolving from environmental bacteria in natural insect populations. Nat. Microbiol. 1, 1–7 (2016).Article 
CAS 

Google Scholar 
17.Gupta, A. & Nair, S. Dynamics of insect–microbiome interaction influence host and microbial symbiont. Front. Microbiol. 11, 1357 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
18.Lutzoni, F. & Pagel, M. Accelerated evolution as a consequence of transitions to mutualism. Proc. Natl Acad. Sci. USA 94, 11422–11427 (1997).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
19.Kaltenpoth, M. et al. Partner choice and fidelity stabilize coevolution in a Cretaceous-age defensive symbiosis. Proc. Natl Acad. Sci. USA 111, 6359–6364 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Manzano-Marı́n, A. et al. Serial horizontal transfer of vitamin-biosynthetic genes enables the establishment of new nutritional symbionts in aphids’ di-symbiotic systems. ISME J. 14, 259–273 (2020).Article 
CAS 

Google Scholar 
21.Miyauchi, S. et al. Large-scale genome sequencing of mycorrhizal fungi provides insights into the early evolution of symbiotic traits. Nat. Commun. 11, 5125 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
22.McFall-Ngai, M. J. The importance of microbes in animal development: lessons from the squid-Vibrio symbiosis. Annu. Rev. Microbiol. 68, 177–194 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
23.Brown, S. P., Cornforth, D. M. & Mideo, N. Evolution of virulence in opportunistic pathogens: generalism, plasticity, and control. Trends Microbiol. 20, 336–342 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
24.Fisher, R. M., Henry, L. M., Cornwallis, C. K., Kiers, E. T. & West, S. A. The evolution of host-symbiont dependence. Nat. Commun. 8, 15973 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
25.McDowell, J. M. Genomes of obligate plant pathogens reveal adaptations for obligate parasitism. Proc. Natl Acad. Sci. USA 108, 8921–8922 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
26.Wilson, B. A. & Salyers, A. A. Is the evolution of bacterial pathogens an out-of-body experience? Trends Microbiol. 11, 347–350 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Sachs, J. L., Mueller, U. G., Wilcox, T. P. & Bull, J. J. The evolution of cooperation. Q. Rev. Biol. 79, 135–160 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
28.Bull, J. J. & Rice, W. R. Distinguishing mechanisms for the evolution of co-operation. J. Theor. Biol. 149, 63–74 (1991).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
29.Sachs, J. L., Skophammer, R. G., Bansal, N. & Stajich, J. E. Evolutionary origins and diversification of proteobacterial mutualists. Proc. Biol. Sci. 281, 20132146 (2014).PubMed 
PubMed Central 

Google Scholar 
30.Duron, O. et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog. 11, e1004892 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
31.Clayton, A. L. et al. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect–bacterial symbioses. PLoS Genet. 8, e1002990 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
32.West, S. A., Kiers, E. T., Simms, E. L. & Denison, R. F. Sanctions and mutualism stability: why do rhizobia fix nitrogen? Proc. Biol. Sci. 269, 685–694 (2002).PubMed 
PubMed Central 
Article 

Google Scholar 
33.Sørensen, M. E. S. et al. The role of exploitation in the establishment of mutualistic microbial symbioses. FEMS Microbiol. Lett. 366, fnz148 (2019).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
34.Trivers, R. L. The evolution of reciprocal altruism. Q. Rev. Biol. 46, 35–57 (1971).Article 

Google Scholar 
35.Frederickson, M. E. Mutualisms are not on the verge of breakdown. Trends Ecol. Evol. 32, 727–734 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
36.Mueller, U. G., Ishak, H., Lee, J. C., Sen, R. & Gutell, R. R. Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models. Antonie Van Leeuwenhoek 98, 195–212 (2010).PubMed 
PubMed Central 
Article 

Google Scholar 
37.Dietel, A.-K., Kaltenpoth, M. & Kost, C. Convergent evolution in intracellular elements: plasmids as model endosymbionts. Trends Microbiol. 26, 755–768 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
38.Hurst, G. D. D. Extended genomes: symbiosis and evolution. Interface Focus. 7, 20170001 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
39.Melnyk, R. A., Hossain, S. S. & Haney, C. H. Convergent gain and loss of genomic islands drive lifestyle changes in plant-associated Pseudomonas. ISME J. 13, 1575–1588 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
40.King, K. C. et al. Rapid evolution of microbe-mediated protection against pathogens in a worm host. ISME J. 10, 1915–1924 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.Shapiro, J. W. & Turner, P. E. Evolution of mutualism from parasitism in experimental virus populations. Evolution 72, 707–712 (2018).PubMed 
Article 

Google Scholar 
42.Zhang, H. et al. A 2-kb mycovirus converts a pathogenic fungus into a beneficial endophyte for brassica protection and yield enhancement. Mol. Plant. 13, 1420–1433 (2020).CAS 
PubMed 
Article 

Google Scholar 
43.Tso, G. H. W. et al. Experimental evolution of a fungal pathogen into a gut symbiont. Science 362, 589–595 (2018).CAS 
PubMed 
Article 

Google Scholar 
44.Harrison, E., Guymer, D., Spiers, A. J., Paterson, S. & Brockhurst, M. A. Parallel compensatory evolution stabilizes plasmids across the parasitism-mutualism continuum. Curr. Biol. 25, 2034–2039 (2015).CAS 
PubMed 
Article 

Google Scholar 
45.Porter, S. S., Faber-Hammond, J., Montoya, A. P., Friesen, M. L. & Sackos, C. Dynamic genomic architecture of mutualistic cooperation in a wild population of Mesorhizobium. ISME J. 13, 301–315 (2019).PubMed 
Article 

Google Scholar 
46.Herrera, P. et al. Molecular causes of an evolutionary shift along the parasitism–mutualism continuum in a bacterial symbiont. Proc. Natl Acad. Sci. USA 117, 21658–21666 (2020).CAS 
PubMed 
Article 

Google Scholar 
47.Li, E. et al. Rapid evolution of bacterial mutualism in the plant rhizosphere. Preprint at bioRxiv https://doi.org/10.1101/2020.12.07.414607 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
48.Pankey, M. S. et al. Host-selected mutations converging on a global regulator drive an adaptive leap towards symbiosis in bacteria. eLife 6, e24414 (2017).Article 

Google Scholar 
49.Jansen, G. et al. Evolutionary transition from pathogenicity to commensalism: global regulator mutations mediate fitness gains through virulence attenuation. Mol. Biol. Evol. 32, 2883–2896 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Chain, P. S. G. et al. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 101, 13826–13831 (2004).CAS 
PubMed 
Article 

Google Scholar 
51.Hendry, T. A. et al. Ongoing transposon-mediated genome reduction in the luminous bacterial symbionts of deep-sea ceratioid anglerfishes. mBio 9, e01033-18 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Nygaard, S. et al. Reciprocal genomic evolution in the ant–fungus agricultural symbiosis. Nat. Commun. 7, 12233 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
53.Bennett, G. M. & Moran, N. A. Heritable symbiosis: the advantages and perils of an evolutionary rabbit hole. Proc. Natl Acad. Sci. USA 112, 10169–10176 (2015).CAS 
PubMed 
Article 

Google Scholar 
54.Gluck-Thaler, E. et al. Repeated gain and loss of a single gene modulates the evolution of vascular pathogen lifestyles. bioRxiv https://doi.org/10.1101/2020.04.24.058529 (2020).Article 

Google Scholar 
55.Arredondo-Alonso, S. et al. Plasmids shaped the recent emergence of the major nosocomial pathogen Enterococcus faecium. mBio 11, e03284-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
56.Driscoll, T. P. et al. Evolution of Wolbachia mutualism and reproductive parasitism: insight from two novel strains that co-infect cat fleas. Preprint at bioRxiv https://doi.org/10.1101/2020.06.01.128066 (2020).Article 

Google Scholar 
57.Frantzeskakis, L. et al. Signatures of host specialization and a recent transposable element burst in the dynamic one-speed genome of the fungal barley powdery mildew pathogen. BMC Genomics 19, 381 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
58.Savory, E. A. et al. Evolutionary transitions between beneficial and phytopathogenic Rhodococcus challenge disease management. eLife 6, e30925 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
59.Barreto, H. C., Sousa, A. & Gordo, I. The landscape of adaptive evolution of a gut commensal bacteria in aging mice. Curr. Biol. 30, 1102–1109.e5 (2020).CAS 
PubMed 
Article 

Google Scholar 
60.Parkhill, J. et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, 523–527 (2001).CAS 
PubMed 
Article 

Google Scholar 
61.Deng, W. et al. Genome sequence of Yersinia pestis KIM. J. Bacteriol. 184, 4601–4611 (2002).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
62.Achtman, M. et al. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 96, 14043–14048 (1999).CAS 
PubMed 
Article 

Google Scholar 
63.Rasmussen, S. et al. Early divergent strains of Yersinia pestis in Eurasia 5,000 years ago. Cell 163, 571–582 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
64.Hinnebusch, B. J. et al. Role of Yersinia murine toxin in survival of Yersinia pestis in the midgut of the flea vector. Science 296, 733–735 (2002).CAS 
PubMed 
Article 

Google Scholar 
65.Lindler, L. E., Plano, G. V., Burland, V., Mayhew, G. F. & Blattner, F. R. Complete DNA sequence and detailed analysis of the Yersinia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect. Immun. 66, 5731–5742 (1998).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
66.Du, Y., Rosqvist, R. & Forsberg, Å. Role of fraction 1 antigen of Yersinia pestis in inhibition of phagocytosis. Infect. Immun. 70, 1453–1460 (2002).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
67.Sun, Y.-C., Jarrett, C. O., Bosio, C. F. & Hinnebusch, B. J. Retracing the evolutionary path that led to flea-borne transmission of Yersinia pestis. Cell Host Microbe 15, 578–586 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
68.Ohnishi, M., Kurokawa, K. & Hayashi, T. Diversification of Escherichia coli genomes: are bacteriophages the major contributors? Trends Microbiol. 9, 481–485 (2001).CAS 
PubMed 
Article 

Google Scholar 
69.Franzin, F. M. & Sircili, M. P. Locus of enterocyte effacement: a pathogenicity island involved in the virulence of enteropathogenic and enterohemorragic Escherichia coli subjected to a complex network of gene regulation. Biomed. Res. Int. 2015, 534738 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
70.Brito, I. L. et al. Mobile genes in the human microbiome are structured from global to individual scales. Nature 535, 435–439 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
71.Broaders, E., O’Brien, C., Gahan, C. G. M. & Marchesi, J. R. Evidence for plasmid-mediated salt tolerance in the human gut microbiome and potential mechanisms. FEMS Microbiol. Ecol. 92, fiw019 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
72.McCarthy, A. J. et al. Extensive horizontal gene transfer during Staphylococcus aureus co-colonization in vivo. Genome Biol. Evol. 6, 2697–2708 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
73.Frazão, N., Sousa, A., Lässig, M. & Gordo, I. Horizontal gene transfer overrides mutation in Escherichia coli colonizing the mammalian gut. Proc. Natl Acad. Sci. USA 116, 17906–17915 (2019).PubMed 
Article 
CAS 

Google Scholar 
74.Niehus, R., Mitri, S., Fletcher, A. G. & Foster, K. R. Migration and horizontal gene transfer divide microbial genomes into multiple niches. Nat. Commun. 6, 8924 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
75.Koonin, E. V. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions. F1000Res https://doi.org/10.12688/f1000research.8737.1 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
76.Nowack, E. C. M. et al. Gene transfers from diverse bacteria compensate for reductive genome evolution in the chromatophore of Paulinella chromatophora. Proc. Natl Acad. Sci. USA 113, 12214–12219 (2016).CAS 
PubMed 
Article 

Google Scholar 
77.Bordenstein, S. R. & Bordenstein, S. R. Eukaryotic association module in phage WO genomes from Wolbachia. Nat. Commun. 7, 13155 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
78.Waterworth, S. C. et al. Horizontal gene transfer to a defensive symbiont with a reduced genome in a multipartite beetle microbiome. mBio 11, e02430-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
79.Ma, W., Dong, F. F. T., Stavrinides, J. & Guttman, D. S. Type III effector diversification via both pathoadaptation and horizontal transfer in response to a coevolutionary arms race. PLoS Genet. 2, e209 (2006).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
80.Nikoh, N. et al. Evolutionary origin of insect–Wolbachia nutritional mutualism. Proc. Natl Acad. Sci. USA 111, 10257–10262 (2014).CAS 
PubMed 
Article 

Google Scholar 
81.Sheppard, S. K., Guttman, D. S. & Fitzgerald, J. R. Population genomics of bacterial host adaptation. Nat. Rev. Genet. 19, 549–565 (2018).CAS 
PubMed 
Article 

Google Scholar 
82.Day, T., Gandon, S., Lion, S. & Otto, S. P. On the evolutionary epidemiology of SARS-CoV-2. Curr. Biol. 30, R849–R857 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
83.Tardy, L., Giraudeau, M., Hill, G. E., McGraw, K. J. & Bonneaud, C. Contrasting evolution of virulence and replication rate in an emerging bacterial pathogen. Proc. Natl Acad. Sci. USA 116, 16927–16932 (2019).CAS 
PubMed 
Article 

Google Scholar 
84.Alves, J. M. et al. Parallel adaptation of rabbit populations to myxoma virus. Science 363, 1319–1326 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
85.Kerr, P. J. Myxomatosis in Australia and Europe: a model for emerging infectious diseases. Antivir. Res. 93, 387–415 (2012).CAS 
PubMed 
Article 

Google Scholar 
86.Longdon, B. et al. The causes and consequences of changes in virulence following pathogen host shifts. PLoS Pathog. 11, e1004728 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
87.van Boven, M. et al. Detecting emerging transmissibility of avian influenza virus in human households. PLoS Comput. Biol. 3, e145 (2007).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
88.Moses, A. S., Millar, J. A., Bonazzi, M., Beare, P. A. & Raghavan, R. Horizontally acquired biosynthesis genes boost Coxiella burnetii’s physiology. Front. Cell Infect. Microbiol. 7, 174 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
89.Flórez, L. V. et al. Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism. Nat. Commun. 8, 1–9 (2017).Article 

Google Scholar 
90.Anderson, R. M. & May, R. M. Coevolution of hosts and parasites. Parasitology 85, 411–426 (1982).PubMed 
Article 

Google Scholar 
91.Ewald, P. W. Host-parasite relations, vectors, and the evolution of disease severity. Annu. Rev. Ecol. Syst. 14, 465–485 (1983).Article 

Google Scholar 
92.Bull, J. J. Perspective: Virulence. Evolution 48, 1423–1437 (1994).CAS 
PubMed 

Google Scholar 
93.Rafaluk, C., Jansen, G., Schulenburg, H. & Joop, G. When experimental selection for virulence leads to loss of virulence. Trends Parasitol. 31, 426–434 (2015).PubMed 
Article 

Google Scholar 
94.Alizon, S. & Van Baalen, M. Transmission-virulence trade-offs in vector-borne diseases. Theor. Popul. Biol. 74, 6–15 (2008).PubMed 
Article 

Google Scholar 
95.Cressler, C. E., McLeod, D. V., Rozins, C., Hoogen, J. V. D. & Day, T. The adaptive evolution of virulence: a review of theoretical predictions and empirical tests. Parasitology 143, 915–930 (2016).PubMed 
Article 

Google Scholar 
96.Axelrod, R. & Hamilton, W. D. The evolution of cooperation. Science 211, 1390–1396 (1981).CAS 
PubMed 
Article 

Google Scholar 
97.Yamamura, N. Vertical transmission and evolution of mutualism from parasitism. Theor. Popul. Biol. 44, 95–109 (1993).Article 

Google Scholar 
98.Hall, J. P. J., Brockhurst, M. A., Dytham, C. & Harrison, E. The evolution of plasmid stability: are infectious transmission and compensatory evolution competing evolutionary trajectories? Plasmid 91, 90–95 (2017).CAS 
PubMed 
Article 

Google Scholar 
99.Kiers, E. T. & Denison, R. F. Sanctions, cooperation, and the stability of plant-rhizosphere mutualisms. Annu. Rev. Ecol. Evol. Syst. 39, 215–236 (2008).Article 

Google Scholar 
100.Werner, G. D. A. et al. Symbiont switching and alternative resource acquisition strategies drive mutualism breakdown. Proc. Natl Acad. Sci. USA 115, 5229–5234 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
101.Herre, E. A. et al. The evolution of mutualisms: exploring the paths between conflict and cooperation. Trends Ecol. Evol. 14, 49–53 (1999).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
102.Nussbaumer, A. D., Fisher, C. R. & Bright, M. Horizontal endosymbiont transmission in hydrothermal vent tubeworms. Nature 441, 345–348 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
103.Dusi, E., Krenek, S., Petzoldt, T., Kaltz, O. & Berendonk, T. U. When enemies do not become friends: experimental evolution of heat-stress adaptation in a vertically transmitted parasite. Preprint at bioRxiv https://doi.org/10.1101/2020.01.23.917773 (2020).Article 

Google Scholar 
104.Engelstädter, J. & Hurst, G. D. D. The ecology and evolution of microbes that manipulate host reproduction. Annu. Rev. Ecol. Evol. Syst. 40, 127–149 (2009).Article 

Google Scholar 
105.Fenton, A., Johnson, K. N., Brownlie, J. C. & Hurst, G. D. D. Solving the Wolbachia paradox: modeling the tripartite interaction between host, Wolbachia, and a natural enemy. Am. Nat. 178, 333–342 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
106.Zug, R. & Hammerstein, P. Evolution of reproductive parasites with direct fitness benefits. Heredity 120, 266–281 (2018).PubMed 
Article 
PubMed Central 

Google Scholar 
107.Drew, G. C., Frost, C. L. & Hurst, G. D. Reproductive parasitism and positive fitness effects of heritable microbes. in eLS https://onlinelibrary.wiley.com/doi/abs/10.1002/9780470015902.a0028327 (2019).108.Parratt, S. R. et al. Superparasitism drives heritable symbiont epidemiology and host sex ratio in a wasp. PLoS Pathog. 12, e1005629 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
109.Sachs, J. L. & Wilcox, T. P. A shift to parasitism in the jellyfish symbiont Symbiodinium microadriaticum. Proc. Biol. Sci. 273, 425–429 (2006).PubMed 
PubMed Central 

Google Scholar 
110.Le Clec’h, W., Dittmer, J., Raimond, M., Bouchon, D. & Sicard, M. Phenotypic shift in Wolbachia virulence towards its native host across serial horizontal passages. Proc. Biol. Sci. 284, 20171076 (2017).PubMed 
PubMed Central 

Google Scholar 
111.Stewart, A. D., Logsdon, J. M. & Kelley, S. E. An empirical study of the evolution of virulence under both horizontal and vertical transmission. Evolution 59, 730–739 (2005).PubMed 
Article 
PubMed Central 

Google Scholar 
112.Rigaud, T., Souty-Grosset, C., Raimond, R., Mocquard, J.-P. & Juchault, P. Feminizing endocytobiosis in the terrestrial crustacean Armadilidium vulgare Latr. (isopoda) – recent acquisitions. Cell Res. 15, 259–273 (1991).
Google Scholar 
113.King, K. C. Defensive symbionts. Curr. Biol. 29, R78–R80 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
114.Flórez, L. V., Biedermann, P. H. W., Engl, T. & Kaltenpoth, M. Defensive symbioses of animals with prokaryotic and eukaryotic microorganisms. Nat. Prod. Rep. 32, 904–936 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
115.Couret, J., Huynh-Griffin, L., Antolic-Soban, I., Acevedo-Gonzalez, T. S. & Gerardo, N. M. Even obligate symbioses show signs of ecological contingency: impacts of symbiosis for an invasive stinkbug are mediated by host plant context. Ecol. Evol. 9, 9087–9099 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
116.Ashby, B. & King, K. Friendly foes: the evolution of host protection by a parasite. Evol. Lett. 1, 211–221 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
117.Duron, O. Arsenophonus insect symbionts are commonly infected with APSE, a bacteriophage involved in protective symbiosis. FEMS Microbiol. Ecol. 90, 184–194 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
118.Ferrari, J., Darby, A. C., Daniell, T. J., Godfray, H. C. J. & Douglas, A. E. Linking the bacterial community in pea aphids with host-plant use and natural enemy resistance. Ecol. Entomol. 29, 60–65 (2004).Article 

Google Scholar 
119.Oliver, K. M., Russell, J. A., Moran, N. A. & Hunter, M. S. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl Acad. Sci. USA 100, 1803–1807 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
120.Polin, S., Simon, J.-C. & Outreman, Y. An ecological cost associated with protective symbionts of aphids. Ecol. Evol. 4, 826–830 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
121.Degnan, P. H., Yu, Y., Sisneros, N., Wing, R. A. & Moran, N. A. Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors. Proc. Natl Acad. Sci. USA 106, 9063–9068 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
122.Weldon, S. R., Strand, M. R. & Oliver, K. M. Phage loss and the breakdown of a defensive symbiosis in aphids. Proc. Biol. Sci. 280, 20122103 (2013).CAS 
PubMed 
PubMed Central 

Google Scholar 
123.Weeks, A. R., Turelli, M., Harcombe, W. R., Reynolds, K. T. & Hoffmann, A. A. From parasite to mutualist: rapid evolution of Wolbachia in natural populations of Drosophila. PLoS Biol. 5, e114 (2007).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
124.Kwong, W. K., del Campo, J., Mathur, V., Vermeij, M. J. A. & Keeling, P. J. A widespread coral-infecting apicomplexan with chlorophyll biosynthesis genes. Nature 568, 103–107 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
125.Tuovinen, V. et al. Two basidiomycete fungi in the cortex of wolf lichens. Curr. Biol. 29, 476–483.e5 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
126.Spribille, T. et al. Basidiomycete yeasts in the cortex of ascomycete macrolichens. Science 353, 488–492 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
127.Coyte, K. Z. & Rakoff-Nahoum, S. Understanding competition and cooperation within the mammalian gut microbiome. Curr. Biol. 29, R538–R544 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
128.Lopez-Medina, E. et al. Candida albicans inhibits Pseudomonas aeruginosa virulence through suppression of pyochelin and pyoverdine biosynthesis. PLoS Pathog. 11, e1005129 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
129.Harriott, M. M. & Noverr, M. C. Candida albicans and Staphylococcus aureus form polymicrobial biofilms: effects on antimicrobial resistance. Antimicrob. Agents Chemother. 53, 3914–3922 (2009).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
130.Diebel, L. N., Liberati, D. M., Diglio, C. A., Dulchavsky, S. A. & Brown, W. J. Synergistic effects of Candida and Escherichia coli on gut barrier function. J. Trauma. Acute Care Surg. 47, 1045 (1999).CAS 
Article 

Google Scholar 
131.Barroso-Batista, J. et al. Specific eco-evolutionary contexts in the mouse gut reveal Escherichia coli metabolic versatility. Curr. Biol. 30, 1049–1062.e7 (2020).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
132.King, K. C., Stevens, E. & Drew, G. C. Microbiome: evolution in a world of interaction. Curr. Biol. 30, R265–R267 (2020).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
133.Zilber-Rosenberg, I. & Rosenberg, E. Role of microorganisms in the evolution of animals and plants: the hologenome theory of evolution. FEMS Microbiol. Rev. 32, 723–735 (2008).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
134.Douglas, A. E. & Werren, J. H. Holes in the hologenome: why host-microbe symbioses are not holobionts. mBio 7, e02099 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
135.Bakken, J. S. et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clin. Gastroenterol. Hepatol. 9, 1044–1049 (2011).PubMed 
PubMed Central 
Article 

Google Scholar 
136.Bourtzis, K. et al. Harnessing mosquito–Wolbachia symbiosis for vector and disease control. Acta Tropica 132, S150–S163 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
137.O’Neill, S. L. in Dengue and Zika: Control and Antiviral Treatment Strategies (eds Hilgenfeld, R. & Vasudevan, S. G.) 355–360 (Springer, 2018).138.Nelson, P. G. & May, G. Coevolution between mutualists and parasites in symbiotic communities may lead to the evolution of lower virulence. Am. Nat. 190, 803–817 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
139.Nelson, P. & May, G. Defensive symbiosis and the evolution of virulence. Am. Nat. 196, 333–343 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
140.Ford, S. A. & King, K. C. Harnessing the power of defensive microbes: evolutionary implications in nature and disease control. PLoS Pathog. 12, e1005465 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
141.Nowak, M. A. & May, R. M. Superinfection and the evolution of parasite virulence. Proc. Biol. Sci. 255, 81–89 (1994).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
142.Alizon, S., de Roode, J. C. & Michalakis, Y. Multiple infections and the evolution of virulence. Ecol. Lett. 16, 556–567 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
143.Frank, S. A. Host–symbiont conflict over the mixing of symbiotic lineages. Proc. Biol. Sci. 263, 339–344 (1996).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
144.Ford, S. A., Kao, D., Williams, D. & King, K. C. Microbe-mediated host defence drives the evolution of reduced pathogen virulence. Nat. Commun. 7, 1–9 (2016).Article 
CAS 

Google Scholar 
145.Engl, T. et al. Evolutionary stability of antibiotic protection in a defensive symbiosis. Proc. Natl Acad. Sci. USA 115, E2020–E2029 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
146.Foster, K. R., Schluter, J., Coyte, K. Z. & Rakoff-Nahoum, S. The evolution of the host microbiome as an ecosystem on a leash. Nature 548, 43–51 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
147.Schneider, D. S. & Ayres, J. S. Two ways to survive infection: what resistance and tolerance can teach us about treating infectious diseases. Nat. Rev. Immunol. 8, 889–895 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
148.Voges, M. J. E. E. E., Bai, Y., Schulze-Lefert, P. & Sattely, E. S. Plant-derived coumarins shape the composition of an Arabidopsis synthetic root microbiome. Proc. Natl Acad. Sci. USA 116, 12558–12565 (2019).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
149.Gandon, S. & Michalakis, Y. Evolution of parasite virulence against qualitative or quantitative host resistance. Proc. Biol. Sci. 267, 985–990 (2000).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
150.Best, A., White, A. & Boots, M. The coevolutionary implications of host tolerance. Evolution 68, 1426–1435 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
151.Bor, B. et al. Rapid evolution of decreased host susceptibility drives a stable relationship between ultrasmall parasite TM7x and its bacterial host. Proc. Natl Acad. Sci. USA 115, 12277–12282 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
152.Schulte, R. D., Makus, C., Hasert, B., Michiels, N. K. & Schulenburg, H. Multiple reciprocal adaptations and rapid genetic change upon experimental coevolution of an animal host and its microbial parasite. Proc. Natl Acad. Sci. USA 107, 7359–7364 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
153.Kerr, P. J. et al. Next step in the ongoing arms race between myxoma virus and wild rabbits in Australia is a novel disease phenotype. Proc. Natl Acad. Sci. USA 114, 9397–9402 (2017).CAS 
PubMed 
Article 

Google Scholar 
154.Kiers, E. T., Rousseau, R. A., West, S. A. & Denison, R. F. Host sanctions and the legume–rhizobium mutualism. Nature 425, 78–81 (2003).CAS 
PubMed 
Article 

Google Scholar 
155.Frederickson, M. E. Rethinking mutualism stability: cheaters and the evolution of sanctions. Q. Rev. Biol. 88, 269–295 (2013).PubMed 
Article 

Google Scholar 
156.Kiers, E. T. et al. Reciprocal rewards stabilize cooperation in the mycorrhizal symbiosis. Science 333, 880–882 (2011).CAS 
PubMed 
Article 

Google Scholar 
157.Fitt, W. K. & Trench, R. K. The relation of diel patterns of cell division to diel patterns of motility in the symbiotic dinoflagellate Symbiodinium microadriaticum Freudenthal in culture. N. Phytol. 94, 421–432 (1983).Article 

Google Scholar 
158.Wilkerson, F. P., Kobayashi, D. & Muscatine, L. Mitotic index and size of symbiotic algae in Caribbean reef corals. Coral Reefs 7, 29–36 (1988).Article 

Google Scholar 
159.Lowe, C. D., Minter, E. J., Cameron, D. D. & Brockhurst, M. A. Shining a light on exploitative host control in a photosynthetic endosymbiosis. Curr. Biol. 26, 207–211 (2016).CAS 
PubMed 
Article 

Google Scholar 
160.Kodama, Y. & Fujishima, M. Symbiotic Chlorella variabilis incubated under constant dark conditions for 24 hours loses the ability to avoid digestion by host lysosomal enzymes in digestive vacuoles of host ciliate Paramecium bursaria. FEMS Microbiol. Ecol. 90, 946–955 (2014).CAS 
PubMed 
Article 

Google Scholar 
161.Iwai, S., Fujita, K., Takanishi, Y. & Fukushi, K. Photosynthetic endosymbionts benefit from host’s phagotrophy, including predation on potential competitors. Curr. Biol. 29, 3114–3119.e3 (2019).CAS 
PubMed 
Article 

Google Scholar 
162.Reisser, W. et al. Viruses distinguish symbiotic Chlorella spp. of Paramecium bursaria. Endocytobiosis Cell Res. 7, 245–251 (1991).
Google Scholar 
163.Ahmadjian, V. The lichen symbiosis. Ann. Botany 75, 101–102 (1993).
Google Scholar 
164.Wilson, C. G. & Sherman, P. W. Anciently asexual bdelloid rotifers escape lethal fungal parasites by drying up and blowing away. Science 327, 574–576 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
165.Matsuura, Y. et al. Recurrent symbiont recruitment from fungal parasites in cicadas. Proc. Natl Acad. Sci. USA 115, E5970–E5979 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
166.Bergstrom, C. T. & Lachmann, M. The Red King effect: when the slowest runner wins the coevolutionary race. Proc. Natl Acad. Sci. USA 100, 593–598 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
167.Veller, C., Hayward, L. K., Hilbe, C. & Nowak, M. A. The Red Queen and King in finite populations. Proc. Natl Acad. Sci. USA 114, E5396–E5405 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
168.Vigneron, A. et al. Insects recycle endosymbionts when the benefit is over. Curr. Biol. 24, 2267–2273 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
169.Baker, D. M., Freeman, C. J., Wong, J. C. Y., Fogel, M. L. & Knowlton, N. Climate change promotes parasitism in a coral symbiosis. ISME J. 12, 921–930 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
170.Hom, E. F. Y. & Murray, A. W. Niche engineering demonstrates a latent capacity for fungal-algal mutualism. Science 345, 94–98 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
171.Hall, J. P. J. et al. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects. Env. Microbiol. 17, 5008–5022 (2015).CAS 
Article 

Google Scholar 
172.Banaszak, A. T., García Ramos, M. & Goulet, T. L. The symbiosis between the gastropod Strombus gigas and the dinoflagellate Symbiodinium: an ontogenic journey from mutualism to parasitism. J. Exp. Mar. Biol. Ecol. 449, 358–365 (2013).Article 

Google Scholar 
173.Nakazawa, T. & Katayama, N. Stage-specific parasitism by a mutualistic partner can increase the host abundance. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2020.602675 (2020).Article 

Google Scholar 
174.Wintermute, E. H. & Silver, P. A. Emergent cooperation in microbial metabolism. Mol. Syst. Biol. 6, 407 (2010).PubMed 
PubMed Central 
Article 

Google Scholar 
175.Yurtsev, E. A., Conwill, A. & Gore, J. Oscillatory dynamics in a bacterial cross-protection mutualism. Proc. Natl Acad. Sci. USA 113, 6236–6241 (2016).CAS 
PubMed 
Article 

Google Scholar 
176.Hoek, T. A. et al. Resource availability modulates the cooperative and competitive nature of a microbial cross-feeding mutualism. PLoS Biol. 14, e1002540 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
177.Hillesland, K. L. & Stahl, D. A. Rapid evolution of stability and productivity at the origin of a microbial mutualism. Proc. Natl Acad. Sci. USA 107, 2124–2129 (2010).CAS 
PubMed 
Article 

Google Scholar 
178.Regus, J. U., Gano, K. A., Hollowell, A. C., Sofish, V. & Sachs, J. L. Lotus hosts delimit the mutualism–parasitism continuum of Bradyrhizobium. J. Evol. Biol. 28, 447–456 (2015).CAS 
PubMed 
Article 

Google Scholar 
179.Hay, M. E. et al. Mutualisms and aquatic community structure: the enemy of my enemy is my friend. Annu. Rev. Ecol. Evol. Syst. 35, 175–197 (2004).Article 

Google Scholar 
180.Pike, V. L., Lythgoe, K. A. & King, K. C. On the diverse and opposing effects of nutrition on pathogen virulence. Proc. Biol. Sci. 286, 20191220 (2019).PubMed 
PubMed Central 

Google Scholar 
181.Corbin, C., Heyworth, E. R., Ferrari, J. & Hurst, G. D. D. Heritable symbionts in a world of varying temperature. Heredity 118, 10–20 (2017).CAS 
PubMed 
Article 

Google Scholar 
182.Thomas, M. B. & Blanford, S. Thermal biology in insect-parasite interactions. Trends Ecol. Evol. 18, 344–350 (2003).Article 

Google Scholar 
183.Delor, I. & Cornelis, G. R. Role of Yersinia enterocolitica Yst toxin in experimental infection of young rabbits. Infect. Immun. 60, 4269–4277 (1992).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
184.Kouse, A. B., Righetti, F., Kortmann, J., Narberhaus, F. & Murphy, E. R. RNA-mediated thermoregulation of iron-acquisition genes in Shigella dysenteriae and pathogenic Escherichia coli. PLoS ONE 8, e63781 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
185.Kishimoto, M., Baird, A. H., Maruyama, S., Minagawa, J. & Takahashi, S. Loss of symbiont infectivity following thermal stress can be a factor limiting recovery from bleaching in cnidarians. ISME J. 14, 3149–3152 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
186.Zhang, B., Leonard, S. P., Li, Y. & Moran, N. A. Obligate bacterial endosymbionts limit thermal tolerance of insect host species. Proc. Natl Acad. Sci. USA 116, 24712–24718 (2019).CAS 
PubMed 
Article 

Google Scholar 
187.Guay, J.-F., Boudreault, S., Michaud, D. & Cloutier, C. Impact of environmental stress on aphid clonal resistance to parasitoids: role of Hamiltonella defensa bacterial symbiosis in association with a new facultative symbiont of the pea aphid. J. Insect Physiol. 55, 919–926 (2009).CAS 
PubMed 
Article 

Google Scholar 
188.Bensadia, F., Boudreault, S., Guay, J.-F., Michaud, D. & Cloutier, C. Aphid clonal resistance to a parasitoid fails under heat stress. J. Insect Physiol. 52, 146–157 (2006).CAS 
PubMed 
Article 

Google Scholar 
189.Vorburger, C. & Gouskov, A. Only helpful when required: a longevity cost of harbouring defensive symbionts. J. Evol. Biol. 24, 1611–1617 (2011).CAS 
PubMed 
Article 

Google Scholar 
190.Parratt, S. R. & Laine, A.-L. The role of hyperparasitism in microbial pathogen ecology and evolution. ISME J. 10, 1815–1822 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
191.Kamada, N., Chen, G. Y., Inohara, N. & Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 14, 685–690 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
192.Hajishengallis, G. & Lamont, R. J. Dancing with the stars: how choreographed bacterial interactions dictate nososymbiocity and give rise to keystone pathogens, accessory pathogens, and pathobionts. Trends Microbiol. 24, 477–489 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
193.Neville, B. A., d’Enfert, C. & Bougnoux, M.-E. Candida albicans commensalism in the gastrointestinal tract. FEMS Yeast Res. 15, fov081 (2015).PubMed 
Article 
CAS 

Google Scholar 
194.Chow, J., Tang, H. & Mazmanian, S. K. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr. Opin. Immunol. 23, 473–480 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
195.Bonhoeffer, S., Lenski, R. E. & Ebert, D. The curse of the pharaoh: the evolution of virulence in pathogens with long living propagules. Proc. Biol. Sci. 263, 715–721 (1996).CAS 
PubMed 
Article 

Google Scholar 
196.Rafaluk-Mohr, C. The relationship between parasite virulence and environmental persistence: a meta-analysis. Parasitology 146, 897–902 (2019).PubMed 
Article 

Google Scholar 
197.Ebert, D., Joachim Carius, H., Little, T. & Decaestecker, E. The evolution of virulence when parasites cause host castration and gigantism. Am. Nat. 164, S19–S32 (2004).PubMed 
Article 

Google Scholar 
198.McCutcheon, J. P., Boyd, B. M. & Dale, C. The life of an insect endosymbiont from the cradle to the grave. Curr. Biol. 29, R485–R495 (2019).CAS 
PubMed 
Article 

Google Scholar 
199.Moran, N. A. Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc. Natl Acad. Sci. USA 93, 2873–2878 (1996).CAS 
PubMed 
Article 

Google Scholar 
200.Moran, N. A., McCutcheon, J. P. & Nakabachi, A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42, 165–190 (2008).CAS 
PubMed 
Article 

Google Scholar 
201.Wernegreen, J. J. Reduced selective constraint in endosymbionts: elevation in radical amino acid replacements occurs genome-wide. PLoS ONE 6, e28905 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
202.Wernegreen, J. J. Genome evolution in bacterial endosymbionts of insects. Nat. Rev. Genet. 3, 850–861 (2002).CAS 
PubMed 
Article 

Google Scholar 
203.Mao, M., Yang, X. & Bennett, G. M. Evolution of host support for two ancient bacterial symbionts with differentially degraded genomes in a leafhopper host. Proc. Natl Acad. Sci. USA 115, E11691–E11700 (2018).CAS 
PubMed 
Article 

Google Scholar 
204.Husnik, F. et al. Horizontal gene transfer from diverse bacteria to an insect genome enables a tripartite nested mealybug symbiosis. Cell 153, 1567–1578 (2013).CAS 
PubMed 
Article 

Google Scholar 
205.Łukasik, P. et al. Multiple origins of interdependent endosymbiotic complexes in a genus of cicadas. Proc. Natl Acad. Sci. USA 115, E226–E235 (2018).PubMed 
Article 
CAS 

Google Scholar 
206.Keeling, P. J., McCutcheon, J. P. & Doolittle, W. F. Symbiosis becoming permanent: survival of the luckiest. Proc. Natl Acad. Sci. USA 112, 10101–10103 (2015).CAS 
PubMed 
Article 

Google Scholar 
207.Karnkowska, A. et al. A eukaryote without a mitochondrial organelle. Curr. Biol. 26, 1274–1284 (2016).CAS 
PubMed 
Article 

Google Scholar 
208.John, U. et al. An aerobic eukaryotic parasite with functional mitochondria that likely lacks a mitochondrial genome. Sci. Adv. 5, eaav1110 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
209.Venkova, T., Yeo, C. C. & Espinosa, M. Editorial: The good, the bad, and the ugly: multiple roles of bacteria in human life. Front. Microbiol. 9, 1702 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
210.Cirstea, M., Radisavljevic, N. & Finlay, B. B. Good bug, bad bug: breaking through microbial stereotypes. Cell Host Microbe 23, 10–13 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
211.Durack, J. & Lynch, S. V. The gut microbiome: relationships with disease and opportunities for therapy. J. Exp. Med. 216, 20–40 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
212.Leonard, S. P. et al. Engineered symbionts activate honey bee immunity and limit pathogens. Science 367, 573–576 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
213.Wolinska, J. & King, K. C. Environment can alter selection in host–parasite interactions. Trends Parasitol. 25, 236–244 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
214.Kiers, E. T., Palmer, T. M., Ives, A. R., Bruno, J. F. & Bronstein, J. L. Mutualisms in a changing world: an evolutionary perspective. Ecol. Lett. 13, 1459–1474 (2010).Article 

Google Scholar 
215.Lafferty, K. D. The ecology of climate change and infectious diseases. Ecology 90, 888–900 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
216.Magalon, H., Nidelet, T., Martin, G. & Kaltz, O. Host growth conditions influence experimental evolution of life history and virulence of a parasite with vertical and horizontal transmission. Evolution 64, 2126–2138 (2010).PubMed 
PubMed Central 

Google Scholar 
217.Bull, J. J., Molineux, I. J. & Rice, W. R. Selection of benevolence in a host-parasite system. Evolution 45, 875–882 (1991).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
218.Gibson, A. K. et al. The evolution of reduced antagonism—a role for host–parasite coevolution. Evolution 69, 2820–2830 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
219.Kubinak, J. L. & Potts, W. K. Host resistance influences patterns of experimental viral adaptation and virulence evolution. Virulence 4, 410–418 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
220.Matthews, A. C., Mikonranta, L. & Raymond, B. Shifts along the parasite–mutualist continuum are opposed by fundamental trade-offs. Proc. Biol. Sci. 286, 20190236 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
221.Marchetti, M. et al. Experimental evolution of a plant pathogen into a legume symbiont. PLoS Biol. 8, e1000280 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
222.Ruby, E. G. et al. Complete genome sequence of Vibrio fischeri: a symbiotic bacterium with pathogenic congeners. Proc. Biol. Sci. 102, 3004–3009 (2005).CAS 

Google Scholar 
223.Jeon, K. W. Genetic and physiological interactions in the amoeba-bacteria symbiosis. J. Eukaryot. Microbiol. 51, 502–508 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
224.Wang, X. et al. Cryptic prophages help bacteria cope with adverse environments. Nat. Commun. 1, 1–9 (2010).PubMed Central 

Google Scholar 
225.Bull, J. J. & Molineux, I. J. Molecular genetics of adaptation in an experimental model of cooperation. Evolution 46, 882–895 (1992).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
226.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. An ancient but promiscuous host-symbiont association between Burkholderia gut symbionts and their heteropteran hosts. ISME J. 5, 446–460 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
227.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. Insect-microbe mutualism without vertical transmission: a stinkbug acquires a beneficial gut symbiont from the environment every generation. Appl. Env. Microbiol. 73, 4308–4316 (2007).CAS 
Article 

Google Scholar 
228.Shapiro, J. W., Williams, E. S. C. P. & Turner, P. E. Evolution of parasitism and mutualism between filamentous phage M13 and Escherichia coli. PeerJ 4, e2060 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
229.Porter, S. S. & Simms, E. L. Selection for cheating across disparate environments in the legume-rhizobium mutualism. Ecol. Lett. 17, 1121–1129 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
230.Weese, D. J., Heath, K. D., Dentinger, B. T. M. & Lau, J. A. Long-term nitrogen addition causes the evolution of less-cooperative mutualists. Evolution 69, 631–642 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
231.Slater, S. C. et al. Genome sequences of three Agrobacterium biovars help elucidate the evolution of multichromosome genomes in bacteria. J. Bacteriol. 191, 2501–2511 (2009).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
232.Proença, J. T., Barral, D. C. & Gordo, I. Commensal-to-pathogen transition: one-single transposon insertion results in two pathoadaptive traits in Escherichia coli–macrophage interaction. Sci. Rep. 7, 4504 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
233.Hu, G. et al. Microevolution during serial mouse passage demonstrates FRE3 as a virulence adaptation gene in Cryptococcus neoformans. mBio 5, e00941-14 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
234.Chrostek, E. et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 9, e1003896 (2013).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
235.Sicard, M. et al. When mutualists are pathogens: an experimental study of the symbioses between Steinernema (entomopathogenic nematodes) and Xenorhabdus (bacteria). J. Evol. Biol. 17, 985–993 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
236.Margulis, L. Words as battle cries: symbiogenesis and the new field of endocytobiology. BioScience 40, 673–677 (1990).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
237.Didelot, X., Barker, M., Falush, D. & Priest, F. G. Evolution of pathogenicity in the Bacillus cereus group. Syst. Appl. Microbiol. 32, 81–90 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
238.Oishi, S., Moriyama, M., Koga, R. & Fukatsu, T. Morphogenesis and development of midgut symbiotic organ of the stinkbug Plautia stali (Hemiptera: Pentatomidae). Zool. Lett. 5, 16 (2019).Article 

Google Scholar 
239.Kang, Y. et al. HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis. PLoS Pathog. 10, e1004232 (2014).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
240.Joy, J. B., Liang, R. H., McCloskey, R. M., Nguyen, T. & Poon, A. F. Y. Ancestral reconstruction. PLoS Comput. Biol. 12, e1004763 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
241.Rafaluk-Mohr, C., Ashby, B., Dahan, D. A. & King, K. C. Mutual fitness benefits arise during coevolution in a nematode-defensive microbe model. Evol. Lett. 2, 246–256 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
242.Ford, S. A., Williams, D., Paterson, S. & King, K. C. Co-evolutionary dynamics between a defensive microbe and a pathogen driven by fluctuating selection. Mol. Ecol. 26, 1778–1789 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
243.Hall, A. R., Ashby, B., Bascompte, J. & King, K. C. Measuring coevolutionary dynamics in species-rich communities. Trends Ecol. Evol. 35, 539–550 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
244.Betts, A., Rafaluk, C. & King, K. C. Host and parasite evolution in a tangled bank. Trends Parasitol. 32, 863–873 (2016).PubMed 
Article 
PubMed Central 

Google Scholar 
245.Partridge, S. R., Kwong, S. M., Firth, N. & Jensen, S. O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 31, e00088-17 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
246.Unterholzner, S. J., Poppenberger, B. & Rozhon, W. Toxin-antitoxin systems: biology, identification, and application. Mob. Genet. Elem. 3, e26219 (2013).Article 
CAS 

Google Scholar 
247.Croucher, N. J. et al. Rapid pneumococcal evolution in response to clinical interventions. Science 331, 430–434 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
248.Wu, M. et al. Phylogenomics of the reproductive parasite wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2, E69 (2004).PubMed 
PubMed Central 
Article 

Google Scholar 
249.Frost, C. L. et al. The hypercomplex genome of an insect reproductive parasite highlights the importance of lateral gene transfer in symbiont biology. mBio 11, e02590-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
250.Bamford, D. H. Do viruses form lineages across different domains of life? Res. Microbiol. 154, 231–236 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
251.Casjens, S. et al. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35, 490–516 (2000).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
252.Casjens, S. Prophages and bacterial genomics: what have we learned so far? Mol. Microbiol. 49, 277–300 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar  More

1.Holmstrum, P. et al. Interactions between effects of environmental chemicals and natural stressors: A review. Sci. Total Environ. 408, 3746–3762 (2010).ADS 
Article 
CAS 

Google Scholar 
2.Wahl, O. & Ulm, K. Influence of pollen feeding and physiological condition on pesticide sensitivity of the honey bee Apis mellifera carnica. Oecologia 59, 106–128 (1983).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
3.Schmehl, D. R., Teal, P. E. A., Frazier, J. L. & Grozinger, C. M. Genomic analysis of the interaction between pesticide exposure and nutrition in honey bees (Apis mellifera). J. Insect Physiol. 71, 177–190 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
4.Tosi, S., Nieh, J. C., Sgolastra, F., Cabbri, R. & Medrzycki, P. Neonicotinoid pesticides and nutritional stress synergistically reduce survival in honey bees. Proc. Biol. Sci. 284, 20171711 (2017).PubMed 
PubMed Central 

Google Scholar 
5.Stuligross, C. & Williams, N. M. Pesticide and resource stressors additively impair wild bee reproduction. Proc. Biol. Sci. 287, 20201390 (2020).PubMed 
PubMed Central 

Google Scholar 
6.Liess, M., Foit, K., Knillmann, S., Schäfer, R. B. & Liess, H.-D. Predicting the synergy of multiple stress effects. Sci. Rep. 6, 32965 (2016).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
7.Goulson, D., Nicholls, E., Botias, C. & Rotheray, E. L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 347, 1255957 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
8.Simpson, S. J. & Raubenheimer, D. The Nature of Nutrition: A Unifying Framework from Animal Adaptation to Human Obesity (Princeton University Press, 2012).
Google Scholar 
9.Simpson, S. J., Le Couteur, D. G. & Raubenheimer, D. Putting the balance back in diet. Cell 161, 18–23 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
10.Wise, D. Food limitation of the spider Linyphia marginata: Experimental field studies. Ecology 56, 637–646 (1975).Article 

Google Scholar 
11.Bilde, T. & Toft, S. Quantifying food limitation of arthropod predators in the field. Oecologia 115, 54–58 (1998).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Wilder, S. M. & Rypstra, A. Diet quality affects mating behaviour and egg production in a wolf spider. Anim. Behav. 76, 439–445 (2008).Article 

Google Scholar 
13.Tanaka, K. & Itô, Y. Decrease in respiratory rate in a wolf spider, Pardosa astrigera (L. Koch), under starvation. Res. Popul. Ecol. 24, 360–374 (1982).Article 

Google Scholar 
14.O’Connor, K. I., Taylor, A. C. & Metcalfe, N. B. The stability of standard metabolic rate during a period of food deprivation in juvenile Atlantic salmon. J. Fish Biol. 57, 41–51 (2000).Article 

Google Scholar 
15.McCue, M. D. Specific dynamic action: A century of investigation. Comp. Biochem. Physiol. A. 144, 381394 (2006).Article 
CAS 

Google Scholar 
16.Secor, S. M. Specific dynamic action: A review of the postprandial metabolic response. J. Comp. Physiol. B 179, 1–56 (2009).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
17.Van Leeuwen, T. E., Rosenfeld, J. S. & Richards, J. G. Effects of food ration on SMR: Influence of food consumption on individual variation in metabolic rate in juvenile coho salmon (Onchorhynchus kisutch). J. Anim. Ecol. 81, 395–402 (2012).PubMed 
Article 
PubMed Central 

Google Scholar 
18.Parthasarathy, B. & Somanathan, H. Body condition and food shapes group dispersal but not solitary dispersal in a social spider. Behav. Ecol. 29, 619–627 (2018).Article 

Google Scholar 
19.Koemel, N. A., Barnes, C. L. & Wilder, S. M. Metabolic and behavioral responses of predators to prey nutrient content. J. Insect Physiol. 116, 25–31 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Řezáč, M., Řezáčová, V. & Heneberg, P. Neonicotinoid insecticides limit the potential of spiders to re-colonize disturbed agroecosystems when using silk-mediated dispersal. Sci. Rep. 9, 12272 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
21.Řezáč, M., Řezáčová, V. & Heneberg, P. Contact application of neonicotinoids suppresses the predation rate in different densities of prey and induces paralysis of common farmland spiders. Sci. Rep. 9, 5724 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
22.Fagan, W. F. et al. Nitrogen in insects: implications for trophic complexity and species diversification. Am. Nat. 160, 784–802 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
23.Raubenheimer, D., Mayntz, D., Simpson, S. J. & Tøft, S. Nutrient-specific compensation following diapause in a predator: Implications for intraguild predation. Ecology 88, 2598–2608 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
24.Lease, H. M. & Wolf, B. O. Exoskeletal chitin scales iso¬metrically with body size in terrestrial insects. J. Morphol. 271, 759–768 (2010).PubMed 
PubMed Central 

Google Scholar 
25.Wilder, S. M., Norris, M., Lee, R. W., Raubenheimer, D. & Simpson, S. J. Arthropod food webs become increasingly lipid-limited at higher trophic levels. Ecol. Lett. 16, 895–902 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
26.Salomon, M., Mayntz, D. & Lubin, Y. Colony nutrition skews reproduction in a social spider. Behav. Ecol. 19, 605–611 (2008).Article 

Google Scholar 
27.Jensen, K., Mayntz, D., Wang, T., Simpson, S. J. & Overgaard, J. Metabolic consequences of feeding and fasting on nutritionally different diets in the wolf spider Pardosa prativaga. J. Insect Physiol. 56, 1095–1100 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
28.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Nutrient regulation in a predator, the wolf spider Pardosa prativaga. Anim. Behav. 81, 993–999 (2011).Article 

Google Scholar 
29.Wiggins, W. D. & Wilder, S. M. Mismatch between dietary requirements for lipid by a predator and availability of lipid in prey. Oikos 127, 1024–1032 (2018).CAS 
Article 

Google Scholar 
30.Uetz, G. W., Bischoff, J. & Raver, J. Survivorship of wolf spiders (Lycosidae) reared on different diets. J. Arachnol. 20, 207–211 (1992).
Google Scholar 
31.Sigsgaard, L., Toft, S. & Villareal, S. Diet-dependent survival, development and fecundity of the spider Atypena formosana (Oi) (Araneae: Linyphiidae) implications for biological control in rice. Biocontrol Sci. Technol. 11, 233–244 (2001).Article 

Google Scholar 
32.Fisker, E. N. & Toft, S. Effects of chronic exposure to a toxic prey in a generalist predator. Physiol. Entomol. 29, 129–138 (2004).Article 

Google Scholar 
33.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Prey nutrient composition has different effects on Pardosa wolf spiders with dissimilar life histories. Oecologia 165, 577–583 (2011).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
34.Wilder, S. M. Spider nutrition: An integrative perspective. Adv. Insect Physiol. 40, 87–136 (2011).Article 

Google Scholar 
35.Barnes, C. L., Hawlena, D. & Wilder, S. M. Predators buffer the effects of variation in prey nutrient content for nutrient deposition. Oikos 128, 360–367 (2019).Article 

Google Scholar 
36.Jensen, K. et al. Optimal foraging for specific nutrients in predatory beetles. Proc. R. Soc. B 279, 2212–2218 (2012).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
37.Toft, S. & Macías-Hernández, N. Metabolic adaptations for isopod specialization in three species of Dysdera spiders from the Canary Islands. Physiol. Entomol. 42, 191–198 (2017).CAS 
Article 

Google Scholar 
38.Barry, K. L. & Wilder, S. M. Macronutrient intake affects reproduction of a predatory insect. Oikos 122, 1058–1064 (2013).Article 

Google Scholar 
39.Wilder, S. M. & Schneider, J. M. Micronutrient consumption by female Argiope bruennichi affects offspring survival. J. Insect Physiol. 100, 128–132 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
40.Demaree, S. R., Gilbert, C. D., Mersmann, H. J. & Smith, S. B. Conjugated linoleic acid differentially modifies fatty acid composition in subcellular fractions of muscle and adipose tissue but not adiposity of postweaning pigs. J. Nutr. 132, 3272–3279 (2002).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
41.Nagao, K. & Yanagita, T. Conjugated fatty acids in food and their health benefits. J. Biosci. Bioeng. 100, 152–157 (2005).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
42.Hennessy, A. A., Ross, P. R., Fitzgerald, G. F. & Stanton, C. Sources and bioactive properties of conjugated dietary fatty acids. Lipids 51, 377–397 (2016).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Hawley, J., Simpson, S. J. & Wilder, S. M. Effects of prey macronutrient content on body composition and nutrient intake in a web-building spider. PLoS ONE 9, e99165 (2014).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
44.Whitehorn, P. R., O’Connor, S., Wackers, F. L. & Goulson, D. Neonicotinoid pesticide reduces bumble bee colony growth and queen production. Science 336, 351–352 (2012).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
45.Dicks, L. Bees, lies and evidence-based policy. Nature 494, 283 (2013).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
46.Rundlöf, M. et al. Seed coating with a neonicotinoid insecticide negatively affects wild bees. Nature 521, 77–80 (2015).ADS 
PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
47.Tsvetkov, N. et al. Chronic exposure to neonicotinoids reduces honey bee health near corn crops. Science 356, 1395–1397 (2017).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
48.Woodcock, B. A. et al. Country-specific effects of neonicotinoid pesticides on honey bees and wild bees. Science 356, 1393–1395 (2017).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
49.Song, F. et al. Specific loops D, E and F of nicotinic acetylcholine receptor β1 subunit may confer imidacloprid selectivity between Myzus persicae and its predatory enemy Pardosa pseudoannulata. Insect Biochem. Mol. Biol. 39, 833–841 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
50.Korenko, S., Sýkora, J., Řezáč, M. & Heneberg, P. Neonicotinoids suppress contact chemoreception in a common farmland spider. Sci. Rep. 10, 7019 (2020).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
51.Benamú, M. et al. Nanostructural and mechanical property changes to spider silk as a consequence of insecticide exposure. Chemosphere 181, 241–249 (2017).ADS 
PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
52.Korenko, S., Saska, P., Kysilková, K., Řezáč, M. & Heneberg, P. Prey contaminated with neonicotinoids induces feeding deterrent behavior of a common farmland spider. Sci. Rep. 9, 15895 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
53.Park, Y. et al. Imidacloprid, a neonicotinoid insecticide, potentiates adipogenesis in 3T3-L1 adipocytes. J. Agric. Food Chem. 61, 255–259 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
54.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity in female C57BL/6J mice and enhances adipogenesis in 3T3-L1 adipocytes via the AMPKα-mediated pathway. J. Agric. Food Chem. 65, 6572–6581 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
55.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity and insulin resistance in male C57BL/6J mice. J. Agric. Food Chem. 64, 9293–9306 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
56.McCluney, K. E. & Sabo, J. L. Water availability directly determines per capita consumption at two trophic levels. Ecology 90, 1463–1469 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
57.McCluney, K. E. & Sabo, J. L. Tracing water sources of terrestrial animal populations with stable isotopes: Laboratory tests with crickets and spiders. PLoS ONE 5, e15696 (2010).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
58.Leinbach, I. L., McCluney, K. E. & Sabo, J. L. Predator water balance alters intraguild predation in a streamside food web. Ecology 100, e02635 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
59.Noldus, L. P., Spink, A. J. & Tegelenbosch, R. A. EthoVision: A versatile video tracking system for automation of behavioral experiments. Behav. Res. Methods Instrum. Comput. 33, 398–414 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
60.Pétillon, J. J., Deruytter, D., Decae, A., Renault, D. & Bonte, D. Habitat use, but not dispersal limitations, as the mechanism behind the aggregated population structure of the mygalomorph species Atypus affinis. Anim. Biol. 62, 181–192 (2012).Article 

Google Scholar 
61.Radwan, M. A. & Mohamed, M. S. Imidacloprid induced alterations in enzyme activities and energy reserves of the land snail, Helix aspersa. Ecotoxicol. Environ. Saf. 95, 91–97 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
62.Ribeiro, S., Sousa, J. P., Nogueira, A. J. A. & Soares, A. M. V. M. Effect of endosulfan and parathion on energy reserves and physiological parameters of the terrestrial isopod Porcellio dilatatus. Ecotoxicol. Environ. Saf. 49, 131–138 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
63.Rambabu, P. J. & Rao, M. B. Effect of an organochlorine and three organophosphate pesticides on glucose, glycogen, lipid and protein contents in tissues of the freshwater snail, Bellamya dissimilis (Müller). Bull. Environ. Contam. Toxicol. 53, 142–148 (1994).CAS 
PubMed 
PubMed Central 

Google Scholar 
64.Dutra, B. K., Fernandes, F. A., Lauffer, A. L. & Oliveira, G. T. Carbofuran-induced alterations in the energy metabolism and reproductive behaviors of Hyalella castroi (Crustacea, Amphipoda). Comp. Biochem. Physiol. Part C 149, 640–646 (2009).CAS 

Google Scholar 
65.Messiad, R., Habes, D. & Soltani, N. Reproductive effects of a neonicotinoid insecticide (Imidacloprid) in the German Cockroaches Blattella germanica L. (Dictyoptera, Blattellidae). J. Entomol. Zool. Stud. 3, 1–6 (2015).
Google Scholar 
66.Abdelsalam, S. A., Alzahrani, A. M., Elmenshawy, O. M., Sedky, A. & Abdel-Moneim, A. M. Biochemical and ultrastructural changes in the ovaries of red palm weevil, Rhynchophorus ferrugineus (Coleoptera: Curculionidae) following acute imidacloprid poisoning. J. Asia Pac. Entomol. 23, 709–714 (2020).Article 

Google Scholar 
67.Tufi, S., Stel, J. M., De Boer, J., Lamoree, M. H. & Leonards, P. E. G. Metabolomics to explore imidacloprid-induced toxicity in the central nervous system of the freshwater snail Lymnaea stagnalis. Environ. Sci. Technol. 49, 14529–14536 (2015).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
68.Ewere, E. E., Reichelt-Brushett, A. & Benkerndorff, K. Imidacloprid and formulated product impacts the fatty acids and enzymatic activities in tissues of Sydney rock oysters, Saccostrea glomerata. Mar. Environ. Res. 151, 104765 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
69.Capowiez, Y., Rault, M., Mazzia, C. & Belzunces, L. Earthworm behavior as a biomarker: A case study using imidacloprid. Pedobiologia 47, 542–547 (2003).
Google Scholar 
70.Drobne, D. et al. Toxicity of imidacloprid to the terrestrial isopod Porcellio scaber (Isopoda, Crustacea). Chemosphere 71, 1326–1334 (2008).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar  More

1.Cadwell, K. The virome in host health and disease. Immunity 42, 805–813 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
2.Paez-Espino, D. et al. Uncovering earth’s virome. Nature https://doi.org/10.1038/nature19094 (2016).Article 
PubMed 

Google Scholar 
3.Shi, M. et al. The evolutionary history of vertebrate RNA viruses. Nature 556, 197–202 (2018).ADS 
CAS 
PubMed 
Article 

Google Scholar 
4.Dolja, V. V. & Koonin, E. V. Metagenomics reshapes the concepts of RNA virus evolution by revealing extensive horizontal virus transfer. Virus Res. 244, 36–52 (2018).CAS 
PubMed 
Article 

Google Scholar 
5.Li, C.-X. et al. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses. Elife 4, e05378 (2015).PubMed Central 
Article 
CAS 
PubMed 

Google Scholar 
6.Shi, M. et al. Redefining the invertebrate RNA virosphere. Nature 540, 539–543 (2016).ADS 
CAS 
PubMed 
Article 

Google Scholar 
7.Atoni, E. et al. Metagenomic Virome Analysis of Culex Mosquitoes from Kenya and China. Viruses 10, 30 (2018).PubMed Central 
Article 
CAS 
PubMed 

Google Scholar 
8.Sadeghi, M. et al. Virome of > 12 thousand Culex mosquitoes from throughout California. Virology 523, 74–88 (2018).CAS 
PubMed 
Article 

Google Scholar 
9.Zakrzewski, M. et al. Mapping the virome in wild-caught Aedes aegypti from Cairns and Bangkok. Nat. Publ. Group https://doi.org/10.1038/s41598-018-22945-y (2018).Article 

Google Scholar 
10.Xia, H. et al. Comparative metagenomic profiling of viromes associated with four common mosquito species in China. Virol. Sin. 33, 59–66 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
11.Frey, K. G. et al. Bioinformatic characterization of mosquito viromes within the eastern United States and Puerto Rico: ciscovery of novel viruses. Evolut. Bioinform. 12s2, EBO.S38518 (2016).Article 

Google Scholar 
12.Chandler, J. A., Liu, R. M. & Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 06, 403 (2015).Article 

Google Scholar 
13.Chandler, J. A. et al. Metagenomic shotgun sequencing of a Bunyavirus in wild-caught Aedes aegypti from Thailand informs the evolutionary and genomic history of the Phleboviruses. Virology 464–465, 312–319 (2014).PubMed 
Article 
CAS 

Google Scholar 
14.Cholleti, H. et al. Discovery of novel viruses in mosquitoes from the Zambezi valley of Mozambique. PLoS ONE 11, e0162751 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
15.Scarpassa, V. M. et al. An insight into the sialotranscriptome and virome of Amazonian anophelines. BMC Genom. https://doi.org/10.1186/s12864-019-5545-0 (2019).Article 

Google Scholar 
16.Hameed, M. et al. A viral metagenomic analysis reveals rich viral abundance and diversity in mosquitoes from pig farms. Transbound. Emerg. Dis. 67, 328–343 (2019).PubMed 
Article 

Google Scholar 
17.Fauver, J. R. et al. West African Anopheles gambiae mosquitoes harbor a taxonomically diverse virome including new insect-speci. Virology 498, 288–299 (2016).CAS 
PubMed 
Article 

Google Scholar 
18.Xiao, P. et al. Metagenomic sequencing from mosquitoes in China reveals a variety of insect and human viruses. Front. Cell. Infect. Microbiol. 8, 131–211 (2018).Article 
CAS 

Google Scholar 
19.Shi, C. et al. Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics. Microbiome https://doi.org/10.1186/s40168-019-0734-2 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
20.World Health Organization. A global brief on vector-borne diseases. (2014).21.Vasilakis, N. & Tesh, R. B. Insect-specific viruses and their potential impact on arbovirus transmission. Curr. Opin. Virol. 15, 69–74 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
22.Goenaga, S. et al. Potential for co-infection of a mosquito-specific flavivirus, Nhumirim virus, to block West Nile virus transmission in mosquitoes. Viruses 7, 5801–5812 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
23.Hall-Mendelin, S. et al. The insect-specific Palm Creek virus modulates West Nile virus infection in and transmission by Australian mosquitoes. Parasit. Vectors 9, 414 (2016).PubMed 
PubMed Central 
Article 

Google Scholar 
24.Colmant, A. M. G. et al. The recently identified flavivirus Bamaga virus is transmitted horizontally by Culex mosquitoes and interferes with West Nile virus replication in vitro and transmission in vivo. PLoS Negl. Trop. Dis. 12, e0006886 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
25.Romo, H., Kenney, J. L., Blitvich, B. J. & Brault, A. C. Restriction of Zika virus infection and transmission in Aedes aegypti mediated by an insect-specific flavivirus. Emerg. Microbes Infect 7, 181 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
26.Schultz, M. J., Frydman, H. M. & Connor, J. H. Dual Insect specific virus infection limits Arbovirus replication in Aedes mosquito cells. Virology 518, 406–413 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
27.Thongsripong, P. et al. Mosquito vector diversity across habitats in central Thailand endemic for dengue and other arthropod-borne diseases. PLoS Negl. Trop. Dis. 7, e2507 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
28.Kukutla, P., Steritz, M. & Xu, J. Depletion of ribosomal RNA for mosquito gut metagenomic RNA-seq. JoVE https://doi.org/10.3791/50093 (2013).Article 
PubMed 

Google Scholar 
29.Rattanarithikul, R., Harrison, B. A. & Panthusiri, P. Coleman RE (2005) Illustrated keys to the mosquitoes of Thailand I. Background; geographic distribution; lists of genera, subgenera, and species; and a key to the genera. Southeast Asian J. Trop. Med. Public Health 36 Suppl 1, 1–80 (2005).PubMed 

Google Scholar 
30.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. II. Genera Culex and Lutzia. Southeast Asian J. Trop. Med. Public Health 36 Suppl 2, 1–97 (2005).PubMed 

Google Scholar 
31.Rattanarithikul, R., Harrison, B. A., Panthusiri, P., Peyton, E. L. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand III. Genera Aedeomyia, Ficalbia, Mimomyia, Hodgesia, Coquillettidia, Mansonia, and Uranotaenia. Southeast Asian J. Trop. Med. Public Health 37 Suppl 1, 1–85 (2006).PubMed 

Google Scholar 
32.Rattanarithikul, R., Harrison, B. A., Harbach, R. E., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J. Trop. Med. Public Health 37 Suppl 2, 1–128 (2006).PubMed 

Google Scholar 
33.Rattanarithikul, R., Harbach, R. E., Harrison, B. A., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand V. Genera Orthopodomyia, Kimia, Malaya, Topomyia, Tripteroides, and Toxorhynchites. Southeast Asian J. Trop. Med. Public Health 38, 1–65 (2007).PubMed 

Google Scholar 
34.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J. Trop. Med. Public Health 41 Suppl 1, 1–225 (2010).PubMed 

Google Scholar 
35.Grabherr, M. G. et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
36.Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 8, 1494–1512 (2013).CAS 
PubMed 
Article 

Google Scholar 
37.Buchfink, B., Xie, C. & Huson, D. H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 12, 59–60 (2015).CAS 
PubMed 
Article 

Google Scholar 
38.Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. https://doi.org/10.1093/bib/bbx108 (2017).Article 
PubMed Central 
PubMed 

Google Scholar 
39.Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
40.Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27, 1164–1165 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. bioRxiv 447110 (2018).42.Miller, M. A., Pfeiffer, W. & Schwartz, T. Creating the CIPRES science gateway for interface of large phylogenetic trees. 1–8 (2010).43.Letunic, I. & Bork, P. Interactive tree of life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. https://doi.org/10.1093/nar/gkz239 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
44.Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
45.Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
46.Ryan, F. P. Human endogenous retroviruses in multiple sclerosis: potential for novel neuro-pharmacological research. Curr. Neuropharmacol. 9, 360–369 (2011).47.Wood, D. E. & Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol 15, R46 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
48.Kopylova, E., Noe, L. & Touzet, H. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217 (2012).CAS 
PubMed 
Article 

Google Scholar 
49.Simmonds, P. et al. ICTV virus taxonomy profile: Flaviviridae. J. Gen. Virol. 98, 2–3 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Kyaw, A. K. et al. Virus research. Virus Res. 247, 120–124 (2018).Article 
CAS 

Google Scholar 
51.Valles, S. M. et al. ICTV virus taxonomy profile: Iflaviridae. J. Gen. Virol. 98, 527–528 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Kobayashi, D. et al. Isolation and characterization of a new iflavirus from Armigeres spp. mosquitoes in the Philippines. J. Gen. Virol. 98, 2876–2881 (2017).CAS 
PubMed 
Article 

Google Scholar 
53.Viruses, I. C. O. T. O., King, A. M. Q., Adams, M. J., Lefkowitz, E. & Carstens, E. B. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier, Amsterdam, 2011).
Google Scholar 
54.Hillman, B. I. & Cai, G. The family narnaviridae: Simplest of RNA viruses. Adv. Virus Res. 86, 149–176 (2013).PubMed 
Article 

Google Scholar 
55.Turina, M. et al. ICTV virus taxonomy profile: Ourmiavirus. J. Gen. Virol. 98, 129–130 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
56.Yong, C. Y., Yeap, S. K., Omar, A. R. & Tan, W. S. Advances in the study of nodavirus. PeerJ 5, e3841 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
57.Sahul Hameed, A. S. et al. ICTV virus taxonomy profile: Nodaviridae. J. Gen. Virol. 100, 3–4 (2019).CAS 
PubMed 
Article 

Google Scholar 
58.Sanborn, M. et al. Metagenomic analysis reveals three novel and prevalent mosquito biruses from a single pool of Aedes vexans nipponii collected in the Republic of Korea. Viruses 11, 222 (2019).CAS 
PubMed Central 
Article 
PubMed 

Google Scholar 
59.Olendraite, I. et al. ICTV virus taxonomy profile: Polycipiviridae. J. Gen. Virol. 100, 554–555 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
60.Wichgers Schreur, P. J., Kormelink, R. & Kortekaas, J. Genome packaging of the Bunyavirales. Curr. Opin. Virol. 33, 151–155 (2018).CAS 
PubMed 
Article 

Google Scholar 
61.Marklewitz, M., Zirkel, F., Kurth, A., Drosten, C. & Junglen, S. Evolutionary and phenotypic analysis of live virus isolates suggests arthropod origin of a pathogenic RNA virus family. Proc. Natl. Acad. Sci. U.S.A. 112, 7536–7541 (2015).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
62.Walker, P. J. et al. ICTV virus taxonomy profile: Rhabdoviridae. J. Gen. Virol. 99, 447–448 (2018).CAS 
PubMed 
Article 

Google Scholar 
63.Sun, Q. et al. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China. Adv. Virol. 162, 1103–1106 (2017).CAS 

Google Scholar 
64.Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A. & Werren, J. H. How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281, 215–220 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
65.Flegontov, P. et al. Paratrypanosoma is a novel early-branching trypanosomatid. Curr Biol 23, 1787–1793 (2013).CAS 
PubMed 
Article 

Google Scholar 
66.Kaur, D. et al. Occurrence of Setaria digitata in a cow. J Parasit Dis 39, 477–478 (2015).CAS 
PubMed 
Article 

Google Scholar 
67.Heneberg, P. et al. Intermediate hosts of the trematode Collyriclum faba (Plagiochiida: Collyriclidae) identified by an integrated morphological and genetic approach. Parasit. Vectors 8, 85 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
68.Enabulele, E. E., Lawton, S. P., Walker, A. J. & Kirk, R. S. Molecular and morphological characterization of the cercariae of Lecithodendrium linstowi (Dollfus, 1931), a trematode of bats, and incrimination of the first intermediate snail host Radix balthica. Parasitology 145, 307–312 (2018).CAS 
PubMed 
Article 

Google Scholar 
69.Greiman, S. E. et al. Real-time PCR detection and phylogenetic relationships of Neorickettsia spp. in digeneans from Egypt, Philippines, Thailand, Vietnam and the United States. Parasitol. Int. 66, 1003–1007 (2017).CAS 
PubMed 
Article 

Google Scholar 
70.Lantova, L. & Volf, P. Mosquito and sand fly gregarines of the genus Ascogregarina and Psychodiella (Apicomplexa: Eugregarinorida, Aseptatorina)—Overview of their taxonomy, life cycle, host specificity and pathogenicity. Infect. Genet. Evol. 28, 616–627 (2014).PubMed 
Article 

Google Scholar 
71.Roychoudhury, S. et al. Comparison of the morphology of oocysts and the phylogenetic analysis of four Ascogregarina species (Eugregarinidae: Lecudinidae) as inferred from small subunit ribosomal DNA sequences. Parasitol. Int. 56, 113–118 (2007).CAS 
PubMed 
Article 

Google Scholar 
72.Muslim, A., Fong, M.-Y., Mahmud, R., Lau, Y.-L. & Sivanandam, S. Armigeres subalbatus incriminated as a vector of zoonotic Brugia pahangi filariasis in suburban Kuala Lumpur Peninsular Malaysia. Parasites Vectors 6, 219 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
73.Hiscox, A. et al. Armigeres subalbatus colonization of damaged pit latrines: A nuisance and potential health risk to residents of resettlement villages in Laos. Med. Vet. Entomol. 30, 95–100 (2016).CAS 
PubMed 
Article 

Google Scholar 
74.Chaves, L. F., Imanishi, N. & Hoshi, T. Population dynamics of Armigeres subalbatus (Diptera: Culicidae) across a temperate altitudinal gradient. Bull. Entomol. Res. 105, 589–597 (2015).CAS 
PubMed 
Article 

Google Scholar 
75.Ohba, S.-Y., Van Soai, N., Van Anh, D. T., Nguyen, Y. T. & Takagi, M. Study of mosquito fauna in rice ecosystems around Hanoi, northern Vietnam. Acta Trop. 142, 89–95 (2015).PubMed 
Article 

Google Scholar 
76.Tsuda, Y., Takagi, M., Suwonkerd, W., Sugiyama, A. & Wada, Y. Comparisons of rice field mosquito (Diptera: Culicidae) abundance among areas with different agricultural practices in northern Thailand. J. Med. Entom. 35, 845–848 (1998).CAS 
Article 

Google Scholar 
77.Ohba, S.-Y. et al. Mosquitoes and their potential predators in rice agroecosystems of the Mekong Delta, southern Vietnam. J. Am. Mosq. Control Assoc. 27, 384–392 (2011).PubMed 
Article 

Google Scholar 
78.Su, C.-L. et al. Molecular epidemiology of Japanese encephalitis virus in mosquitoes in Taiwan during 2005–2012. PLoS Negl. Trop. Dis. 8, e3122 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
79.Keiser, J. et al. Effect of irrigated rice agriculture on Japanese encephalitis, including challenges and opportunities for integrated vector management. Acta Trop. 95, 40–57 (2005).PubMed 
Article 

Google Scholar 
80.Apiwathnasorn, C., Samung, Y., Prummongkol, S., Asavanich, A. & Komalamisra, N. Surveys for natural host plants of Mansonia mosquitoes inhabiting Toh Daeng peat swamp forest, Narathiwat Province, Thailand. Southeast Asian J. Trop. Med. Public Health 37, 279–282 (2006).PubMed 

Google Scholar 
81.Surtees, G., Simpson, D. I. H., Bowen, E. T. W. & Grainger, W. E. Ricefield development and arbovirus epidemiology, Kano Plain, Kenya. Trans. R. Soc. Trop. Med. Hyg. 64, 511–518 (1970).CAS 
PubMed 
Article 

Google Scholar 
82.Kwa, B. H. Environmental change, development and vector-borne disease: Malaysia’s experience with filariasis, scrub typhus and dengue. Environ. Dev. Sustain. 10, 209–217 (2008).Article 

Google Scholar 
83.Cook, S. et al. Molecular evolution of the insect-specific flaviviruses. J. Gen. Virol. 93, 223–234 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
84.Parry, R. & Asgari, S. Aedes anphevirus: an insect-specific virus distributed worldwide in Aedes aegypti mosquitoes that has complex interplays with Wolbachia and Dengue Virus Infection in Cells. J. Virol. 92, e00224–18 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
85.Shi, M. et al. High-resolution metatranscriptomics reveals the ecological dynamics of mosquito-associated RNA viruses in western Australia. J. Virol. 91, e00680–17 (2017).PubMed 
PubMed Central 

Google Scholar 
86.Thongsripong, P. et al. Mosquito vector-associated microbiota: Metabarcoding bacteria and eukaryotic symbionts across habitat types in Thailand endemic for dengue and other arthropod-borne diseases. Ecol. Evol. 8, 1352–1368 (2018).PubMed 
Article 

Google Scholar 
87.Eisenhofer, R. et al. Contamination in low microbial biomass microbiome studies: Issues and recommendations. Trends Microbiol. 27, 105–117 (2019).CAS 
PubMed 
Article 

Google Scholar 
88.Salter, S. J. et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 12, 1–12 (2014).MathSciNet 
Article 
CAS 

Google Scholar 
89.Pollock, J., Glendinning, L., Wisedchanwet, T. & Watson, M. The madness of microbiome: attempting to find consensus ‘best practice’ for 16S microbiome studies. Appl. Environ. Microbiol. 84, e02627–17 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
90.Blair, C. D., Olson, K. E. & Bonizzoni M. The widespread occurrence and potential biological roles of endogenous viral elements in insect genomes. Curr. Issues Mol. Biol. 34, 13–30 (2020).PubMed 
Article 

Google Scholar  More

1.Julkowska MM, Testerink C. Tuning plant signaling and growth to survive salt. Trends Plant Sci. 2015;20:586–94.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
2.Li H, Zhao Q, Huang H. Current states and challenges of salt-affected soil remediation by cyanobacteria. Sci Total Environ. 2019;669:258–72.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
3.FAO. Extent of salt-affected soils. 2020. http://www.fao.org/soils-portal/soil-management/management-of-some-problem-soils/salt-affected-soils/more-information-on-salt-affected-soils/en/. Accessed 14 June 2020.4.Jamil A, Riaz S, Ashraf M, Foolad MR. Gene expression profiling of plants under salt stress. Crit Rev Plant Sci. 2011;30:435–58.Article 

Google Scholar 
5.Ouhibi C, Attia H, Rebah F, Msilini N, Chebbi M, Aarrouf J, et al. Salt stress mitigation by seed priming with UV-C in lettuce plants: Growth, antioxidant activity and phenolic compounds. Plant Physiol Biochem. 2014;83:126–33.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
6.McFarlane DJ, George RJ, Barrett-Lennard EG, Gilfedder M. Salinity in dryland agricultural systems: challenges and opportunities. In: Farooq M, Siddique KHM, editors. Innovations in dryland agriculture. 1st ed. Switzerland: Springer Nature; 2016. p. 521–47.
Google Scholar 
7.Yang Y, Guo Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. N. Phytol. 2018;217:523–39.CAS 
Article 

Google Scholar 
8.Zörb C, Geilfus CM, Dietz KJ. Salinity and crop yield. Plant Biol. 2019;21:31–38.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
9.Flood PJ, Hancock AM. The genomic basis of adaptation in plants. Curr Opin Plant Biol. 2017;36:88–94.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
10.Yuan F, Leng B, Wang B. Progress in studying salt secretion from the salt glands in recretohalophytes: how do plants secrete salt? Front Plant Sci. 2016;7:977.PubMed 
PubMed Central 

Google Scholar 
11.Yang Y, Guo Y. Unraveling salt stress signaling in plants. J Integr Plant Biol. 2018;60:796–804.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Kazan K, Lyons R. The link between flowering time and stress tolerance. J Exp Bot. 2015;67:47–60.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
13.Zhu JK. Abiotic stress signaling and responses in plants. Cell. 2016;167:313–24.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
14.Lowry DB, Hall MC, Salt DE, Willis JH. Genetic and physiological basis of adaptive salt tolerance divergence between coastal and inland Mimulus guttatus. N. Phytol. 2009;183:776–88.Article 

Google Scholar 
15.Ilangumaran G, Smith DL. Plant growth promoting rhizobacteria in amelioration of salinity stress: a systems biology perspective. Front Plant Sci. 2017;8:1768.PubMed 
Article 
PubMed Central 

Google Scholar 
16.Rodriguez PA, Rothballer M, Chowdhury SP, Nussbaumer T, Gutjahr C, Falter-Braun P. Systems biology of plant microbiome interactions. Mol Plant. 2019;12:804–21.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
17.Berendsen RL, Pieterse CM, Bakker PA. The rhizosphere microbiome and plant health. Trends Plant Sci. 2012;17:478–86.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
18.Mhlongo MI, Piater LA, Madala NE, Labuschagne N, Dubery IA. The chemistry of plant–microbe interactions in the rhizosphere and the potential for metabolomics to reveal signaling related to defense priming and induced systemic resistance. Front Plant Sci. 2018;9:112.PubMed 
Article 
PubMed Central 

Google Scholar 
19.Finkel OM, Castrillo G, Paredes SH, González IS, Dangl JL. Understanding and exploiting plant beneficial microbes. Curr Opin Plant Biol. 2017;38:155–63.PubMed 
Article 
PubMed Central 

Google Scholar 
20.Kwak MJ, Kong HG, Choi K, Kwon SK, Song JY, Lee J, et al. Rhizosphere microbiome structure alters to enable wilt resistance in tomato. Nat Biotechnol. 2018;36:1100–9.CAS 
Article 

Google Scholar 
21.Jha B, Gontia I, Hartmann A. The roots of the halophyte Salicornia brachiata are a source of new halotolerant diazotrophic bacteria with plant growth-promoting potential. Plant Soil. 2012;356:265–77.CAS 
Article 

Google Scholar 
22.Qin S, Zhang YJ, Yuan B, Xu PY, Xing K, Wang J, et al. Isolation of ACC deaminase-produ0cing habitat-adapted symbiotic bacteria associated with halophyte Limonium sinense (Girard) Kuntze and evaluating their plant growth-promoting activity under salt stress. Plant Soil. 2014;374:753–66.CAS 
Article 

Google Scholar 
23.Soldan R, Mapelli F, Crotti E, Schnell S, Daffonchio D, Marasco R, et al. Bacterial endophytes of mangrove propagules elicit early establishment of the natural host and promote growth of cereal crops under salt stress. Microbiol Res. 2019;223:33–43.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
24.Bal HB, Nayak L, Das S, Adhya TK. Isolation of ACC deaminase producing PGPR from rice rhizosphere and evaluating their plant growth promoting activity under salt stress. Plant Soil. 2013;366:93–105.CAS 
Article 

Google Scholar 
25.Bharti N, Pandey SS, Barnawal D, Patel VK, Kalra A. Plant growth promoting rhizobacteria Dietzia natronolimnaea modulates the expression of stress responsive genes providing protection of wheat from salinity stress. Sci Rep. 2016;6:34768.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
26.Dong ZY, Rao MPN, Wang HF, Fang BZ, Liu YH, Li L, et al. Transcriptomic analysis of two endophytes involved in enhancing salt stress ability of Arabidopsis thaliana. Sci Total Environ. 2019;686:107–17.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Yaish MW, Al-Lawati A, Jana GA, Patankar HV, Glick BR. Impact of soil salinity on the structure of the bacterial endophytic community identified from the roots of caliph medic (Medicago truncatula). PLoS One. 2016;11:e0159007.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
28.Yang H, Hu J, Long X, Liu Z, Rengel Z. Salinity altered root distribution and increased diversity of bacterial communities in the rhizosphere soil of Jerusalem artichoke. Sci Rep. 2016;6:20687.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
29.Thiem D, Gołębiewski M, Hulisz P, Piernik A, Hrynkiewicz K. How does salinity shape bacterial and fungal microbiomes of Alnus glutinosa roots? Front Microbiol. 2018;9:651.PubMed 
Article 
PubMed Central 

Google Scholar 
30.Paul D, Lade H. Plant-growth-promoting rhizobacteria to improve crop growth in saline soils: a review. Agron Sustain Dev. 2014;34:737–52.Article 

Google Scholar 
31.Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM. The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol. 2006;57:233–66.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
32.Sasse J, Martinoia E, Northen T. Feed your friends: do plant exudates shape the root microbiome? Trends Plant Sci. 2018;23:25–41.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
33.Badri DV, Vivanco JM. Regulation and function of root exudates. Plant Cell Environ. 2009;32:666–81.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
34.Philippot L, Spor A, Hénault C, Bru D, Bizouard F, Jones CM, et al. Loss in microbial diversity affects nitrogen cycling in soil. ISME J. 2013;7:1609–19.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
35.Niu B, Paulson JN, Zheng X, Kolter R. Simplified and representative bacterial community of maize roots. Proc Natl Acad Sci USA. 2017;114:E2450–9.CAS 
PubMed 
Article 

Google Scholar 
36.Vargas R, Pankova E, Balyuk A, Krasilnikov P, Khasankhanova G, editors. Handbook for saline soil management. Food and Agriculture Organization of the United Nations and Lomonosov Moscow State University, Rome, Italy, 2018, pp 8–11.37.McNamara NP, Black HIJ, Beresford NA, Parekh NR. Effects of acute gamma irradiation on chemical, physical and biological properties of soils. Appl Soil Ecol. 2003;24:117–32.Article 

Google Scholar 
38.Bai Y, Müller DB, Srinivas G, Garrido-Oter R, Potthoff E, Rott M, et al. Functional overlap of the Arabidopsis leaf and root microbiota. Nature. 2015;528:364–9.CAS 
PubMed 
Article 

Google Scholar 
39.Carrión VJ, Perez-Jaramillo J, Cordovez V, Tracanna V, de Hollander M, Ruiz-Buck D, et al. Pathogen-induced activation of disease-suppressive functions in the endophytic root microbiome. Science. 2019;366:606–12.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
40.Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6:1621–4.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
41.Zhang J, Liu YX, Zhang N, Hu B, Jin T, Xu H, et al. NRT1. 1B is associated with root microbiota composition and nitrogen use in field-grown rice. Nat Biotechnol. 2019;37:676–84.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
42.Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;26:2460–1.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011;27:2194–200.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
44.Edgar RC. Updating the 97% identity threshold for 16S ribosomal RNA OTUs. Bioinforma (Oxf, Engl). 2018;34:2371–5.CAS 
Article 

Google Scholar 
45.Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73:5261–7.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
46.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
47.Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 2010;26:266–7.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
48.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–6.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
49.Peiffer JA, Spor A, Koren O, Jin Z, Tringe SG, Dangl JL, et al. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc Natl Acad Sci USA. 2013;110:6548–53.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
50.Javůrková VG, Kreisinger J, Procházka P, Požgayová M, Ševčíková K, Brlík V, et al. Unveiled feather microcosm: feather microbiota of passerine birds is closely associated with host species identity and bacteriocin-producing bacteria. ISME J. 2019;13:2363–76.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
51.Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, et al. Community ecology package. R package version 2.5-6. https://cran.r-project.org. Accessed 1 Sep 2019.52.Cáceres MD, Legendre P. Associations between species and groups of sites: indices and statistical inference. Ecology. 2009;90:3566–74.PubMed 
Article 
PubMed Central 

Google Scholar 
53.Louca S, Parfrey LW, Doebeli M. Decoupling function and taxonomy in the global ocean microbiome. Science. 2016;353:1272–7.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
54.Santhanam R, Weinhold A, Goldberg J, Oh Y, Baldwin IT. Native root-associated bacteria rescue a plant from a sudden-wilt disease that emerged during continuous cropping. Proc Natl Acad Sci USA. 2015;112:E5013–20.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
55.Dudenhöffer J-H, Scheu S, Jousset A. Systemic enrichment of antifungal traits in the rhizosphere microbiome after pathogen attack. J Ecol. 2016;104:1566–75.Article 
CAS 

Google Scholar 
56.Kong HG, Kim BK, Song GC, Lee S, Ryu C-M. Aboveground whitefly infestation-mediated reshaping of the root microbiota. Front Microbiol. 2016;7:1314.PubMed 
PubMed Central 

Google Scholar 
57.Berendsen RL, Vismans G, Yu K, Song Y, de Jonge R, Burgman WP, et al. Disease-induced assemblage of a plant-beneficial bacterial consortium. ISME J. 2018;12:1496–507.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
58.Fierer N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat Rev Microbiol. 2017;15:579–90.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
59.Pieterse CM, de Jonge R, Berendsen RL. The soil-borne supremacy. Trends Plant Sci. 2016;21:171–3.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
60.Lämke J, Bäurle I. Epigenetic and chromatin-based mechanisms in environmental stress adaptation and stress memory in plants. Genome Biol. 2017;18:124.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
61.Cominelli E, Conti L, Tonelli C, Galbiati M. Challenges and perspectives to improve crop drought and salinity tolerance. N. Biotechnol. 2013;30:355–61.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
62.Rodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, et al. Stress tolerance in plants via habitat adapted symbiosis. ISME J. 2008;2:404–16.PubMed 
Article 
PubMed Central 

Google Scholar 
63.Hamilton EW III, Frank DA. Can plants stimulate soil microbes and their own nutrient supply? Evidence from a grazing tolerant grass. Ecology. 2001;82:2397–402.Article 

Google Scholar 
64.Cipollini D, Rigsby CM, Barto EK. Microbes as targets and mediators of allelopathy in plants. J Chem Ecol. 2012;38:714–27.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
65.Ahmed V, Verma MK, Gupta S, Mandhan V, Chauhan NS. Metagenomic profiling of soil microbes to mine salt stress tolerance genes. Front Microbiol. 2018;9:159.PubMed 
Article 
PubMed Central 

Google Scholar 
66.Troost TA, Kooi BW, Kooijman SALM. When do mixotrophs specialize? Adaptive dynamics theory applied to a dynamic energy budget model. Math Biosci. 2005;193:159–82.PubMed 
Article 
PubMed Central 

Google Scholar 
67.Venceslau SS, Lino RR, Pereira IA. The Qrc membrane complex, related to the alternative complex III, is a menaquinone reductase involved in sulfate respiration. J Biol Chem. 2010;285:22774–83.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
68.Numan M, Bashir S, Khan Y, Mumtaz R, Shinwari ZK, Khan AL, et al. Plant growth promoting bacteria as an alternative strategy for salt tolerance in plants: a review. Microbiol Res. 2018;209:21–32.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
69.Kumar M, Etesami H, Kumar V, editors. Saline soil-based agriculture by halotolerant microorganisms. Singapore: Springer Nature Singapore Pte Ltd; 2019.
Google Scholar 
70.Etesami H, Glick BR. Halotolerant plant growth–promoting bacteria: Prospects for alleviating salinity stress in plants. Environ Exp Bot. 2020;23:104124.Article 
CAS 

Google Scholar 
71.van der Heijden MG, Schlaeppi K. Root surface as a frontier for plant microbiome research. Proc Natl Acad Sci USA. 2015;112:2299–300.PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
72.Bakhshandeh E, Gholamhosseini M, Yaghoubian Y, Pirdashti H. Plant growth promoting microorganisms can improve germination, seedling growth and potassium uptake of soybean under drought and salt stress. Plant Growth Regul. 2020;90:123–36.CAS 
Article 

Google Scholar 
73.Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S, et al. Defining the core Arabidopsis thaliana root microbiome. Nature. 2012;488:86–90.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
74.van Elsas JD, Chiurazzi M, Mallon CA, Elhottovā D, Krištůfek V, Salles JF. Microbial diversity determines the invasion of soil by a bacterial pathogen. Proc Natl Acad Sci USA. 2012;109:1159–64.PubMed 
Article 
PubMed Central 

Google Scholar 
75.Delgado-Baquerizo M, Maestre FT, Reich PB, Jeffries TC, Gaitan JJ, Encinar D, et al. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat Commun. 2016;7:10541.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
76.Matos A, Kerkhof L, Garland JL. Effects of microbial community diversity on the survival of Pseudomonas aeruginosa in the wheat rhizosphere. Micro Ecol. 2005;49:257–64.CAS 
Article 

Google Scholar 
77.Hol WHG, de Boer W, Termorshuizen AJ, Meyer KM, Schneider JHM, et al. Reduction of rare soil microbes modifies plant–herbivore interactions. Ecol Lett. 2010;13:292–301.PubMed 
Article 
PubMed Central 

Google Scholar 
78.Saleem M, Hu J, Jousset A. More than the sum of its parts: microbiome biodiversity as a driver of plant growth and soil health. Annu Rev Ecol Evol Syst. 2019;50:145–68.Article 

Google Scholar 
79.Fan P, Chen D, He Y, Zhou Q, Tian Y, Gao L. Alleviating salt stress in tomato seedlings using Arthrobacter and Bacillus megaterium isolated from the rhizosphere of wild plants grown on saline–alkaline lands. Int J Phytoremediat. 2016;18:1113–21.CAS 
Article 

Google Scholar 
80.Misra S, Dixit VK, Mishra SK, Chauhan PS. Demonstrating the potential of abiotic stress-tolerant Jeotgalicoccus huakuii NBRI 13E for plant growth promotion and salt stress amelioration. Ann Microbiol. 2019;69:419–34.CAS 
Article 

Google Scholar 
81.Gest H. The discovery of microorganisms by Robert Hooke and Antoni van Leeuwenhoek, fellows of the Royal Society. Notes Rec R Soc Lond. 2004;58:187–201.PubMed 
Article 
PubMed Central 

Google Scholar  More

Preparation of positive controls for molecular testingZIKV strains MR766, PRVABC59, and DakAR41525 were separately propagated on Vero cells (ATCC CCL-81). Cell supernatant was harvested 72 hpi, and RNA extraction was performed using Trizol. Due to undetectable RNA concentration, the maximum input volume of 11 µL was used for cDNA generation using the SuperScript IV First-Strand Synthesis System with random hexamers (Thermo Fisher Scientific, Waltham, MA, United States). A ten-fold dilution series of RNA was generated for each strain to validate detection of phylogenetically divergent strains of ZIKV using our primer set. For all molecular assays, 3 µL of 10−3 of MR766 was used experimentally as the positive control. Propagation of ZIKV was conducted under CSU biosafety protocol 17-059B.Infection protocol, RNA Extraction, and cDNA synthesis for A129 mice and Jamaican fruit batsAll animal studies were carried out in accordance with ARRIVE guidelines and all procedures approved by and carried out under the Colorado State University Institutional Animal Care and Use Committee (protocol 15-6677AA). Three sub-adult male A129 mice and three female Jamaican fruit bats (Artibeus jamaicensis) were obtained from their respective breeding colonies at Colorado State University. Mice were subcutaneously inoculated with 1 × 103 PFU supernatant from PRVABC59-infected Vero cells, and bats were subcutaneously inoculated with 7.5 × 105 PFU supernatant from Vero cells infected with one of three strains (either PRVABC59, MR766, or DakAR41525; one strain per individual). Mice were euthanized at 7 days post-infection (dpi). The bat infected with ZIKV strain MR766 was euthanized at 28 dpi, while the two bats infected with strains PRVABC59 and DakAR41525 were euthanized at 45 dpi to provide a broader of time window in which to characterize sfRNA persistence. Organs and blood were harvested and placed into DMEM supplemented with 1% penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, United States) and 10% FBS (Atlas Biologicals, Fort Collins, CO, United States) and stored at − 80 °C until RNA extraction using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek Inc., Norcross, GA, United States) on the KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific, Waltham, MA, United States). RNA was eluted in 30 µL nuclease-free water.Droplet digital PCR (ddPCR) to detect ZIKV sfRNATo detect ZIKV sfRNA, primers were designed to target the 3′ UTR of multiple strains of ZIKV according to recommended ddPCR primer design guidelines, resulting in an amplicon 123 bp in length (F: TTCCCCACCCTTYAATCTGG and R: TGGTCTTTCCCAGCGTCAAT). Each reaction consisted of 50 ng cDNA, 125 nM foward primer, 125 nM reverse primer, and 10 µL QX200 ddPCR EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA, United States). Following reaction preparation, 20 µL of reaction and 60 µL of QX200 Droplet Generation Oil for EvaGreen (Bio-Rad Laboratories, Hercules, CA, United States) were loaded into a DG8 Cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad Laboratories, Hercules, CA, United States). Following droplet generation, plates were sealed in the PX1 PCR Plate Sealer (Bio-Rad Laboratories, Hercules, CA, United States). PCR was performed on a T100 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, United States), using the following cycling parameters: 95 °C for 5 min, 40 cycles of 95 °C for 30 s followed by 57.5 °C for 1 min, 4 °C for 5 min, 90 °C for 5 min, and held at 4 °C until reading the plate. Plates were read on the QX200 Droplet Reader (Bio-Rad Laboratories, Hercules, CA, United States). Analysis was performed by two individuals using QuantaSoft Software (Bio-Rad Laboratories, Hercules, CA, United States) to determine results.Gradient PCR was performed to identify the optimal annealing temperature, resulting in selection of 57.5 °C (Fig. S1). At this annealing temperature, the ddPCR reaction using the 3′ UTR primers successfully amplified ZIKV strains MR766, DakAR41525, and PRVABC59 (Fig. S2). As an additional and more biologically relevant sample type, 50 ng cDNA from the organs of A129 mice experimentally infected with ZIKV PRVABC59 were tested using this same assay; successful ZIKV sfRNA amplification was obtained from mouse kidney and spleen (Fig. S2). Blood and tissue samples from the three female Jamaican fruit bats were tested in duplicate on the QX200 Droplet Digital (ddPCR) System (Bio-Rad Laboratories, Hercules, CA, United States) using the ZIKV sfRNA primers as described above.Testing of archived samples from free-ranging Ugandan batsThis study utilized archived tissue samples from bats previously captured in Uganda from 2009 to 201318,26 (Table 1). Bats were captured using harp traps or mist nets, identified using a field guide specific to East African bats, and placed in holding bags prior to anesthesia via halothane and euthanasia by cervical dislocation27. This study used historic archived samples from a previous study, in which all bat captures and sampling were conducted under the approval of CDC IACUC protocols 1731AMMULX and 010-015 and carried out according to ARRIVE guidelines. RNA was extracted from frozen tissue homogenates (spleen, and in some cases both spleen and liver separately) using the MagMax 96 total RNA isolation kit (Applied Biosystems, Foster City, CA, United States), and cDNA generation was performed as above. To confirm RNA integrity via amplification of a housekeeping gene, we used previously published primers demonstrated to amplify GAPDH from two Old World bat species (black flying fox and Egyptian rousette bat) and one New World bat species (common vampire bat) (F: GTCGCCATCAATGACCCCTTC and R: TTCAAGTGAGCCCCAGCC)31. For samples with undetectable RNA concentration on the Qubit RNA HS assay, 6 µL cDNA was used as input. ddPCR was performed as above, except that an annealing temperature of 60˚C was used. Plates were read as above, and only samples deemed ‘suspect’ or ‘positive’ for GAPDH amplification were subjected to ddPCR testing with ZIKV sfRNA (3′ UTR). For these samples, the same volume of input cDNA was used to test for the presence of ZIKV sfRNA in duplicate; results were analyzed by two individuals.Table 1 All bat species and trap sites collected from 2009 to 201318,26.Full size tableSequence confirmationTo confirm specific amplification of GAPDH sequence for each of the 8 Old World species, the same primers were used in a conventional PCR assay using GoTaq HotStart Polymerase (Promega corporation, Madison, WI, United States). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 248-bp amplicon via gel electrophoresis. Amplicons were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to aligning forward and reverse reads, and the consensus read was subjected to a BLAST search.Confirmation of ZIKV sfRNA ddPCR results in Ugandan bat samples using conventional PCR and sequencingSamples deemed ‘suspect’ via screening on the ddPCR system with ZIKV 3′ UTR primers were subjected to additional PCR and Sanger sequencing using the same primer set targeting the 3′ UTR of ZIKV. ZIKV strain MR766 was used as a positive control in these assays. Samples were considered ‘suspect’ if (1) the automatically-defined threshold yielded ≥ 1 positive droplet in the same 1D amplitude as the positive control cDNA (ZIKV MR766) or (2) the negative droplet populations existed in the same 1D amplitude region of positive control droplets and thus, precluded the ability to differentiate positive and negative populations. The cDNA from these samples was amplified using the GoTaq HotStart system (Promega corporation, Madison, WI, United States), with each reaction consisting of 50 ng cDNA, 25 µL GoTaq HotStart Master Mix, 400 nM forward primer, 400 nM reverse primer, and 1 M Betaine. Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 123-bp amplicon via gel electrophoresis. Positive samples were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to BLAST search and subsequent alignment of forward and reverse reads with the 3′ UTR of ZIKV MR766 in Geneious v11.1.5 (www.geneious.com).Comparison of detection sensitivity between sfRNA and NS5 in field-caught samplesThe four samples from which ZIKV sfRNA was amplified were subjected to cPCR amplification with GoTaq HotStart MasterMix as described above and primers designed for this study targeting NS5 from MR766, PRVABC59, and DakAR41525 in order to compare detection sensitivity (F: TGC CGC CAC CAA GAT GAA CT, R: CAT TCT CCC TTT CCA TGG ATT GAC C). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C. cDNA from ZIKV MR766 was used as a positive control. Results were sent for Sanger sequencing if a band was present. All methods in this study were carried out in accordance with relevant guidelines and regulations. More

Red Sea Research Center (RSRC), King Abdullah University of Science and Technology, Thuwal, Saudi ArabiaCarlos M. Duarte, Susana Agusti & Milica PredragovicArctic Research Centre, Department of Biology, Aarhus University, Aarhus, DenmarkCarlos M. DuarteComputational Bioscience Research Center (CBRC), King Abdullah University of Science and Technology, Thuwal, Saudi ArabiaCarlos M. DuarteDepartment of Economics, Colorado State University, Fort Collins, CO, USAEdward BarbierDepartment of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA, USAGregory L. BrittenDepartamento de Ecología, Facultad de Ciencias Biológicas and Centro Interdisciplinario de Cambio Global, Pontificia Universidad Católica de Chile, Santiago, ChileJuan Carlos CastillaLaboratoire d’Océanographie de Villefranche, Sorbonne Université, CNRS, Villefranche-sur-Mer, FranceJean-Pierre GattusoInstitute for Sustainable Development and International Relations, Sciences Po, Paris, FranceJean-Pierre GattusoMonegasque Association on Ocean Acidification, Prince Albert II of Monaco Foundation, Monaco, MonacoJean-Pierre GattusoDepartment of Earth & Environment, Boston University, Boston, MA, USARobinson W. FulweilerDepartment of Biology, Boston University, Boston, MA, USARobinson W. FulweilerAustralian Research Council Centre of Excellence for Coral Reef Studies, James Cook University, Townsville, Queensland, AustraliaTerry P. HughesNational Museum of Natural History, Smithsonian Institution, Washington, DC, USANancy KnowltonSchool of Biological Sciences, The University of Queensland, St Lucia, Queensland, AustraliaCatherine E. LovelockDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaHeike K. Lotze & Boris WormAlfred Wegener Institute, Integrative Ecophysiology, Bremerhaven, GermanyElvira PoloczanskaDepartment of Environment and Geography, University of York, York, UKCallum Roberts More

AffiliationsCAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, ChinaHong QianResearch and Collections Center, Illinois State Museum, Springfield, IL, USAHong QianDepartment of Biology, University of Missouri–St. Louis, St. Louis, MO, USARobert E. RicklefsUniv. Grenoble Alpes, Univ. Savoie Mont Blanc, CNRS, LECA, Laboratoire d’Ecologie Alpine, Grenoble, FranceWilfried ThuillerAuthorsHong QianRobert E. RicklefsWilfried ThuillerCorresponding authorCorrespondence to
Hong Qian. More

1.IPCC. The Ocean and Cryosphere in a changing Climate—Summary for Policymakers (2019).2.Carmack, E. et al. Toward quantifying the increasing role of oceanic heat in sea ice loss in the new arctic. Bull. Am. Meteorol. Soc. 96, 2079–2105 (2015).ADS 
Article 

Google Scholar 
3.Crain, C. M., Kroeker, K. & Halpern, B. S. Interactive and cumulative effects of multiple human stressors in marine systems. Ecol. Lett. 11, 1304–1315 (2008).PubMed 
Article 

Google Scholar 
4.Borgå, K. The Arctic ecosystem: a canary in the coal mine for global multiple stressors. Environ. Toxicol. Chem. 38, 487–488 (2019).PubMed 
Article 
CAS 

Google Scholar 
5.Lind, S., Ingvaldsen, R. B. & Furevik, T. Arctic warming hotspot in the northern Barents Sea linked to declining sea-ice import. Nat. Clim. Change 8, 634–639 (2018).ADS 
Article 

Google Scholar 
6.Onarheim, I. H., Eldevik, T., Smedsrud, L. H. & Stroeve, J. C. Seasonal and regional manifestation of Arctic Sea ice loss. J. Clim. 31, 4917–4932 (2018).ADS 
Article 

Google Scholar 
7.Screen, J. A. & Simmonds, I. Increasing fall-winter energy loss from the Arctic Ocean and its role in Arctic temperature amplification. Geophys. Res. Lett. 37, 1–5 (2010).Article 

Google Scholar 
8.Onarheim, I. H. & Årthun, M. Toward an ice-free Barents Sea. Geophys. Res. Lett. 44, 8387–8395 (2017).ADS 
Article 

Google Scholar 
9.Champine, R. D., Morris, R. & Elder, S. The melting Arctic is now open for business. National Geographic Magazine (2019).10.Orourke, R. et al. Changes in the Arctic: Background and Issues for Congress 129 (DIANE Publishing, 2020).
Google Scholar 
11.Eriksen, E., Huserbråten, M., Gjøsæter, H., Vikebø, F. & Albretsen, J. Polar cod egg and larval drift patterns in the Svalbard archipelago. Polar Biol. https://doi.org/10.1007/s00300-019-02549-6 (2019).Article 

Google Scholar 
12.Eguíluz, V. M., Fernández-Gracia, J., Irigoien, X. & Duarte, C. M. A quantitative assessment of Arctic shipping in 2010–2014. Sci. Rep. 6, 30682 (2016).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
13.Ellis, B., & Brigham, L. Arctic Marine Shipping Assessment 2009 Report. (2009).14.Pörtner, H.-O. & Farrell, A. P. Physiology and climate change. Science 322, 690–692 (2008).PubMed 
Article 

Google Scholar 
15.Pollino, C. A. & Holdway, D. A. Toxicity testing of crude oil and related compounds using early life stages of the crimson-spotted rainbowfish (Melanotaenia fluviatilis). Ecotoxicol. Environ. Saf. 52, 180–189 (2002).CAS 
PubMed 
Article 

Google Scholar 
16.Miller, B. & Kendall, A. W. Early Life History of Marine Fishes (University of California Press, 2009). https://doi.org/10.1525/9780520943766.
Google Scholar 
17.Dahlke, F. T. et al. Northern cod species face spawning habitat losses if global warming exceeds 1.5°C. Sci. Adv. 4, 8821 (2018).ADS 
Article 
CAS 

Google Scholar 
18.Petersen, G. I. & Kristensen, P. Bioaccumulation of lipophilic substances in fish early life stages. Environ. Toxicol. Chem. 17, 1385–1395 (1998).CAS 
Article 

Google Scholar 
19.Dahlke, F. T., Wohlrab, S., Butzin, M. & Pörtner, H.-O. Thermal bottlenecks in the life cycle define climate vulnerability of fish. Science 369, 65–70 (2020).ADS 
CAS 
PubMed 
Article 

Google Scholar 
20.Jung, J.-H. et al. Differential toxicokinetics determines the sensitivity of two marine embryonic fish exposed to Iranian heavy crude oil. Environ. Sci. Technol. 49, 13639–13648 (2015).ADS 
CAS 
PubMed 
Article 

Google Scholar 
21.Ingvarsdóttir, A. et al. Effects of different concentrations of crude oil on first feeding larvae of Atlantic herring (Clupea harengus). J. Mar. Syst. 93, 69–76 (2012).Article 

Google Scholar 
22.Pasparakis, C., Esbaugh, A. J., Burggren, W. & Grosell, M. Physiological impacts of deepwater horizon oil on fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 224, 108558 (2019).CAS 
Article 

Google Scholar 
23.Steiner, N. S. et al. Impacts of the changing ocean-sea ice system on the key forage fish arctic cod (Boreogadus saida) and subsistence fisheries in the western Canadian arctic—evaluating linked climate, ecosystem and economic (CEE) models. Front. Mar. Sci. 6, 179 (2019).Article 

Google Scholar 
24.Kortsch, S., Primicerio, R., Fossheim, M., Dolgov, A. V. & Aschan, M. Climate change alters the structure of arctic marine food webs due to poleward shifts of boreal generalists. Proc. R. Soc. B Biol. Sci. 282, 20151546 (2015).Article 

Google Scholar 
25.Harter, B. B., Elliott, K. H., Divoky, G. J. & Davoren, G. K. Arctic cod (Boreogadus saida) as prey: fish length-energetics relationships in the Beaufort Sea and Hudson Bay. Arctic 66, 191–196 (2013).Article 

Google Scholar 
26.Graham, M. & Hop, H. Aspects of reproduction and larval biology of Arctic cod (Boreogadus saida). Arctic 48, 130–135 (1995).Article 

Google Scholar 
27.Gradinger, R. R. & Bluhm, B. A. In-situ observations on the distribution and behavior of amphipods and Arctic cod (Boreogadus saida) under the sea ice of the High Arctic Canada Basin. Polar Biol. 27, 595–603 (2004).Article 

Google Scholar 
28.Laurel, B. J., Copeman, L. A., Spencer, M. & Iseri, P. Comparative effects of temperature on rates of development and survival of eggs and yolk-sac larvae of Arctic cod (Boreogadus saida) and walleye pollock (Gadus chalcogrammus). ICES J. Mar. Sci. 75, 2403–2412 (2018).Article 

Google Scholar 
29.ICES. Report of the Arctic Fisheries Working Group. 859 http://www.ices.dk/sites/pub/Publication%20Reports/Expert%20Group%20Report/acom/2018/AFWG/00-AFWG%202018%20Report.pdf (2018).30.Eriksen, E., Ingvaldsen, R. B., Nedreaas, K. & Prozorkevich, D. The effect of recent warming on polar cod and beaked redfish juveniles in the Barents Sea. Reg. Stud. Mar. Sci. 2, 105–112 (2015).Article 

Google Scholar 
31.Astthorsson, O. S. Distribution, abundance and biology of polar cod, Boreogadus saida, in Iceland–East Greenland waters. Polar Biol. 39, 995–1003 (2016).Article 

Google Scholar 
32.Divoky, G. J., Lukacs, P. M. & Druckenmiller, M. L. Effects of recent decreases in arctic sea ice on an ice-associated marine bird. Prog. Oceanogr. 136, 151–161 (2015).ADS 
Article 

Google Scholar 
33.Hansen, M. O., Nielsen, T. G., Stedmon, C. A. & Munk, P. Oceanographic regime shift during 1997 in Disko Bay, Western Greenland. Limnol. Oceanogr. 57, 634–644 (2012).ADS 
Article 

Google Scholar 
34.Nahrgang, J. et al. Gender specific reproductive strategies of an Arctic key species (Boreogadus saida) and implications of climate change. PLoS ONE 9, e98452 (2014).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
35.Huserbråten, M. B. O., Eriksen, E., Gjøsæter, H. & Vikebø, F. Polar cod in jeopardy under the retreating Arctic sea ice. Commun. Biol. 2, 1–8 (2019).Article 

Google Scholar 
36.Nahrgang, J. et al. Early life stages of an arctic keystone species (Boreogadus saida) show high sensitivity to a water-soluble fraction of crude oil. Environ. Pollut. 218, 605–614 (2016).CAS 
PubMed 
Article 

Google Scholar 
37.Laurel, B. J. et al. Embryonic crude oil exposure impairs growth and lipid allocation in a keystone arctic forage fish. iScience 19, 1101–1113 (2019).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
38.Politis, S. N. et al. Temperature effects on gene expression and morphological development of European eel, Anguilla anguilla larvae. PLoS ONE 12, e0182726 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
39.O’Dea, R. E., Lagisz, M., Hendry, A. P. & Nakagawa, S. Developmental temperature affects phenotypic means and variability: a meta-analysis of fish data. Fish Fish. 20, 1005–1022 (2019).Article 

Google Scholar 
40.Réalis-Doyelle, E., Pasquet, A., De Charleroy, D., Fontaine, P. & Teletchea, F. Strong effects of temperature on the early life stages of a cold stenothermal fish species, brown trout (Salmo trutta L.). PLoS ONE 11, e0155487 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
41.Réalis-Doyelle, E., Pasquet, A., Fontaine, P. & Teletchea, F. How climate change may affect the early life stages of one of the most common freshwater fish species worldwide: the common carp (Cyprinus carpio). Hydrobiologia 805, 365–375 (2018).Article 
CAS 

Google Scholar 
42.Hicken, C. E. et al. Sublethal exposure to crude oil during embryonic development alters cardiac morphology and reduces aerobic capacity in adult fish. Proc. Natl. Acad. Sci. 108, 7086–7090 (2011).ADS 
CAS 
PubMed 
Article 

Google Scholar 
43.Carls, M. G., Rice, S. D. & Hose, J. E. Sensitivity of fish embryos to weathered crude oil: Part I. Low-level exposure during incubation causes malformations, genetic damage, and mortality in larval pacific herring (Clupea pallasi). Environ. Toxicol. Chem. 18, 481–493 (1999).CAS 
Article 

Google Scholar 
44.Incardona, J. P. Molecular mechanisms of crude oil developmental toxicity in fish. Arch. Environ. Contam. Toxicol. 73, 19–32 (2017).CAS 
PubMed 
Article 

Google Scholar 
45.Sørhus, E. et al. Novel adverse outcome pathways revealed by chemical genetics in a developing marine fish. Elife 6, e20707 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
46.Incardona, J. P. & Scholz, N. L. The influence of heart developmental anatomy on cardiotoxicity-based adverse outcome pathways in fish. Aquat. Toxicol. 177, 515–525 (2016).CAS 
PubMed 
Article 

Google Scholar 
47.Perrichon, P. et al. Combined effects of elevated temperature and Deepwater Horizon oil exposure on the cardiac performance of larval mahi–mahi, Coryphaena hippurus. PLoS ONE 13, e0203949 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
48.Pasparakis, C. et al. Combined effects of oil exposure, temperature and ultraviolet radiation on buoyancy and oxygen consumption of embryonic mahi–mahi, Coryphaena hippurus. Aquat. Toxicol. 191, 113–121 (2017).CAS 
PubMed 
Article 

Google Scholar 
49.Pasparakis, C., Mager, E. M., Stieglitz, J. D., Benetti, D. & Grosell, M. Effects of Deepwater Horizon crude oil exposure, temperature and developmental stage on oxygen consumption of embryonic and larval mahi–mahi (Coryphaena hippurus). Aquat. Toxicol. 181, 113–123 (2016).CAS 
PubMed 
Article 

Google Scholar 
50.Gunderson, A. R., Armstrong, E. J. & Stillman, J. H. Multiple stressors in a changing world: the need for an improved perspective on physiological responses to the dynamic marine environment. Annu. Rev. Mar. Sci. 8, 357–378 (2016).ADS 
Article 

Google Scholar 
51.McNicholl, D. G., Davoren, G. K., Majewski, A. R. & Reist, J. D. Isotopic niche overlap between co-occurring capelin (Mallotus villosus) and polar cod (Boreogadus saida) and the effect of lipid extraction on stable isotope ratios. Polar Biol. 41, 423–432 (2018).Article 

Google Scholar 
52.Kühn, S. et al. Plastic ingestion by juvenile polar cod (Boreogadus saida) in the Arctic Ocean. Polar Biol. 41, 1269–1278 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
53.Bouchard, C. & Fortier, L. Circum-arctic comparison of the hatching season of polar cod Boreogadus saida: a test of the freshwater winter refuge hypothesis. Prog. Oceanogr. 90, 105–116 (2011).ADS 
Article 

Google Scholar 
54.Laurel, B. J., Spencer, M., Iseri, P. & Copeman, L. A. Temperature-dependent growth and behavior of juvenile Arctic cod (Boreogadus saida) and co-occurring North Pacific gadids. Polar Biol. 39, 1127–1135 (2016).Article 

Google Scholar 
55.Drost, H. E. et al. Upper thermal limits of the hearts of Arctic cod Boreogadus saida : adults compared with larvae: boreogadus saida thermal limits. J. Fish Biol. 88, 718–726 (2016).CAS 
PubMed 
Article 

Google Scholar 
56.Bender, M. L. et al. Effects of chronic dietary petroleum exposure on reproductive development in polar cod (Boreogadus saida). Aquat. Toxicol. 180, 196–208 (2016).CAS 
PubMed 
Article 

Google Scholar 
57.Bender, M. L. et al. Effects of acute exposure to dispersed oil and burned oil residue on long-term survival, growth, and reproductive development in polar cod (Boreogadus saida). Mar. Environ. Res. 140, 468–477 (2018).CAS 
PubMed 
Article 

Google Scholar 
58.Boehm, P. D., Neff, J. M. & Page, D. S. Assessment of polycyclic aromatic hydrocarbon exposure in the waters of Prince William Sound after the Exxon Valdez oil spill: 1989–2005. Mar. Pollut. Bull. 54, 339–356 (2007).CAS 
PubMed 
Article 

Google Scholar 
59.Sammarco, P. W. et al. Distribution and concentrations of petroleum hydrocarbons associated with the BP/Deepwater Horizon Oil Spill, Gulf of Mexico. Mar. Pollut. Bull. 73, 129–143 (2013).CAS 
PubMed 
Article 

Google Scholar 
60.Berenshtein, I. et al. Invisible oil beyond the Deepwater Horizon satellite footprint. Sci. Adv. 6, eaaw8863 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
61.Incardona, J. P. et al. Cardiac arrhythmia is the primary response of embryonic pacific herring (Clupea pallasi) exposed to crude oil during weathering. Environ. Sci. Technol. 43, 201–207 (2009).ADS 
CAS 
PubMed 
Article 

Google Scholar 
62.Incardona, J. P. et al. Exxon Valdez to Deepwater Horizon: comparable toxicity of both crude oils to fish early life stages. Aquat. Toxicol. Amst. Neth. 142–143, 303–316 (2013).Article 
CAS 

Google Scholar 
63.de Soysa, T. Y. et al. Macondo crude oil from the Deepwater Horizon oil spill disrupts specific developmental processes during zebrafish embryogenesis. BMC Biol. 10, 40 (2012).PubMed 
PubMed Central 
Article 

Google Scholar 
64.Incardona, J. P. et al. Very low embryonic crude oil exposures cause lasting cardiac defects in salmon and herring. Sci. Rep. 5, 13499 (2015).ADS 
PubMed 
PubMed Central 
Article 

Google Scholar 
65.Heintz, R. A. et al. Delayed effects on growth and marine survival of pink salmon Oncorhynchus gorbuscha after exposure to crude oil during embryonic development. Mar. Ecol. Prog. Ser. 208, 205–216 (2000).ADS 
Article 

Google Scholar 
66.Sorheim, K. R. & Moldestad, M. O. Weathering properties of the Goliat Kobbe and two Goliat Blend of Kobbe and Realgrunnen crude oils. (2008).67.Sørensen, L., Melbye, A. G. & Booth, A. M. Oil droplet interaction with suspended sediment in the seawater column: influence of physical parameters and chemical dispersants. Mar. Pollut. Bull. 78, 146–152 (2014).PubMed 
Article 
CAS 

Google Scholar 
68.Sørensen, L. et al. Accumulation and toxicity of monoaromatic petroleum hydrocarbons in early life stages of cod and haddock. Environ. Pollut. 251, 212–220 (2019).PubMed 
Article 
CAS 

Google Scholar 
69.Meador, J. P. & Nahrgang, J. Characterizing crude oil toxicity to early-life stage fish based on a complex mixture: Are we making unsupported assumptions?. Environ. Sci. Technol. 53, 11080–11092 (2019).ADS 
CAS 
PubMed 
Article 

Google Scholar 
70.Sørensen, L. et al. Oil droplet fouling and differential toxicokinetics of polycyclic aromatic hydrocarbons in embryos of Atlantic haddock and cod. PLoS ONE 12, e0180048 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
71.Carls, M. G. et al. Fish embryos are damaged by dissolved PAHs, not oil particles. Aquat. Toxicol. 88, 121–127 (2008).CAS 
PubMed 
Article 

Google Scholar 
72.Hansen, B. H. et al. Developmental effects in fish embryos exposed to oil dispersions—the impact of crude oil micro-droplets. Mar. Environ. Res. 150, 104753 (2019).CAS 
PubMed 
Article 

Google Scholar 
73.Olsvik, P. A., Berntssen, M. H. G., Hylland, K., Eriksen, D. Ø. & Holen, E. Low impact of exposure to environmentally relevant doses of 226Ra in Atlantic cod (Gadus morhua) embryonic cells. J. Environ. Radioact. 109, 84–93 (2012).CAS 
PubMed 
Article 

Google Scholar 
74.Sundby, S. & Kristiansen, T. The principles of buoyancy in marine fish eggs and their vertical distributions across the world oceans. PLoS ONE 10, e0138821 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
75.Spencer, M. L., Vestfals, C. D., Mueter, F. J. & Laurel, B. J. Ontogenetic changes in the buoyancy and salinity tolerance of eggs and larvae of polar cod (Boreogadus saida) and other gadids. Polar Biol. 18, 1141–1158. https://doi.org/10.1007/s00300-020-02620-7 (2020).Article 

Google Scholar 
76.Pasparakis, C., Wang, Y., Stieglitz, J. D., Benetti, D. D. & Grosell, M. Embryonic buoyancy control as a mechanism of ultraviolet radiation avoidance. Sci. Total Environ. 651, 3070–3078 (2019).ADS 
CAS 
PubMed 
Article 

Google Scholar 
77.Kent, D., Drost, H. E., Fisher, J., Oyama, T. & Farrell, A. P. Laboratory rearing of wild Arctic cod Boreogadus saida from egg to adulthood: rearing boreogadus saida from egg to adulthood. J. Fish Biol. 88, 1241–1248 (2016).CAS 
PubMed 
Article 

Google Scholar 
78.Jordaan, A., Hayhurst, S. E. & Kling, L. J. The influence of temperature on the stage at hatch of laboratory reared Gadus morhua and implications for comparisons of length and morphology. J. Fish Biol. 68, 7–24 (2006).Article 

Google Scholar 
79.Porter, S. M. & Bailey, K. M. The effect of early and late hatching on the escape response of walleye pollock (Theragra chalcogramma) larvae. J. Plankton Res. 29, 291–300 (2007).Article 

Google Scholar 
80.Spicer, J. I., Tills, O., Truebano, M. & Rundle, S. D. Developmental plasticity and heterokairy. In Development and Environment (eds Burggren, W. & Dubansky, B.) 73–96 (Springer, 2018). https://doi.org/10.1007/978-3-319-75935-7_4.
Google Scholar 
81.Bouchard, C. et al. Climate warming enhances polar cod recruitment, at least transiently. Prog. Oceanogr. 156, 121–129 (2017).Article 

Google Scholar 
82.Koenker, B. L., Laurel, B. J., Copeman, L. A. & Ciannelli, L. Effects of temperature and food availability on the survival and growth of larval Arctic cod (Boreogadus saida) and walleye pollock (Gadus chalcogrammus). ICES J. Mar. Sci. 75, 2386–2402 (2018).Article 

Google Scholar 
83.Bouchard, C. & Fortier, L. The importance of Calanus glacialis for the feeding success of young polar cod: a circumpolar synthesis. Polar Biol. https://doi.org/10.1007/s00300-020-02643-0 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
84.Balazy, K., Trudnowska, E., Wichorowski, M. & Błachowiak-Samołyk, K. Large versus small zooplankton in relation to temperature in the Arctic shelf region. Polar Res. 37, 1427409 (2018).Article 

Google Scholar 
85.Weydmann, A. et al. Shift towards the dominance of boreal species in the Arctic: inter-annual and spatial zooplankton variability in the West Spitsbergen Current. Mar. Ecol. Prog. Ser. 501, 41–52 (2014).ADS 
Article 

Google Scholar 
86.Marsh, J. M., Mueter, F. J. & Quinn, T. J. Environmental and biological influences on the distribution and population dynamics of polar cod (Boreogadus saida) in the US Chukchi Sea. Polar Biol. https://doi.org/10.1007/s00300-019-02561-w (2019).Article 

Google Scholar 
87.Lange, R. & Marshall, D. Ecologically relevant levels of multiple, common marine stressors suggest antagonistic effects. Sci. Rep. 7, 6281 (2017).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
88.Liess, M., Foit, K., Knillmann, S., Schäfer, R. B. & Liess, H.-D. Predicting the synergy of multiple stress effects. Sci. Rep. 6, 32965 (2016).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
89.du Sert, N. P. et al. Reporting animal research: explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol. 18, e3000411 (2020).Article 
CAS 

Google Scholar 
90.Holst, J. C. & McDonald, A. FISH-LIFT: a device for sampling live fish with trawls. Fish. Res. 48, 87–91 (2000).Article 

Google Scholar 
91.Hall, T. E., Smith, P. & Johnston, I. A. Stages of embryonic development in the Atlantic cod Gadus morhua. J. Morphol. 259, 255–270 (2004).PubMed 
Article 

Google Scholar 
92.Houde, E. D. Mortality. In Fishery Science (ed. Fuiman, L. A.) (Wiley, 1989).
Google Scholar 
93.Sørensen, L., Silva, M. S., Booth, A. M. & Meier, S. Optimization and comparison of miniaturized extraction techniques for PAHs from crude oil exposed Atlantic cod and haddock eggs. Anal. Bioanal. Chem. 408, 1023–1032 (2016).PubMed 
Article 
CAS 

Google Scholar 
94.Sørensen, L., Meier, S. & Mjøs, S. A. Application of gas chromatography/tandem mass spectrometry to determine a wide range of petrogenic alkylated polycyclic aromatic hydrocarbons in biotic samples. Rapid Commun. Mass Spectrom. 30, 2052–2058 (2016).ADS 
PubMed 
Article 
CAS 

Google Scholar 
95.Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 45e–445 (2001).Article 

Google Scholar 
96.Riley, P. & Skirrow, G. Chemical Oceanography 56–74 (Academic Press, 1975).
Google Scholar 
97.Laurel, B. J., Copeman, L. A., Hurst, T. P. & Parrish, C. C. The ecological significance of lipid/fatty acid synthesis in developing eggs and newly hatched larvae of Pacific cod (Gadus macrocephalus). Mar. Biol. 157, 1713–1724 (2010).CAS 
Article 

Google Scholar 
98.Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
99.Wassenberg, D. M. & Di Giulio, R. T. Synergistic embryotoxicity of polycyclic aromatic hydrocarbon aryl hydrocarbon receptor agonists with cytochrome P4501A inhibitors in Fundulus heteroclitus. Environ. Health Perspect. 112, 1658–1664 (2004).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
100.R Core Team. R: A Language and Environment for Statistical Computing. (R Foundation for Statistical Computing, version 2018). https://www.R-project.org/.101.Pinheiro, J., Bates, D., DebRoy, S., Sarkar, D. & Van Willigen, B. nlme: Linear and Nonlinear Mixed Effects Models. (2020).102.Pinheiro, J. & Bates, D. Fitting linear mixed-effects models. In Mixed-Effects Models in S and S-Plus 133–199 (Springer, 2000).103.Zuur, A., Ieno, E. N., Walker, N., Saveliev, A. A. & Smith, G. M. Mixed Effects Models and Extensions in Ecology with R (Springer, 2009).
Google Scholar 
104.Folt, C. L., Chen, C. Y., Moore, M. V. & Burnaford, J. Synergism and antagonism among multiple stressors. Limnol. Oceanogr. 44, 864–877 (1999).ADS 
Article 

Google Scholar 
105.Wasserstein, R. L., Schirm, A. L. & Lazar, N. A. Moving to a world beyond “p < 0.05”. Am. Stat. 73, 1–19 (2019).MathSciNet  Article  Google Scholar  106.Amrheim, V., Greenland, S. & McShane, B. Time to retire statistical significance Nature2019.pdf. Nature 567, 305–307 (2019).ADS  Article  CAS  Google Scholar  More